Human BMP7/OP-1 ORF/cDNA clone-Adenovirus particle (BC008584)

Cat. No.: vGMAP000439

Pre-made Human BMP7/OP-1 Adenovirus for BMP7 overexpression in-vitro and in-vivo. The BMP7 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BMP7-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to BMP-7/BMP7/BMP7/OP-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000439 Human BMP7 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000439
Gene Name BMP7
Accession Number BC008584
Gene ID 655
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1296 bp
Gene Alias OP-1
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCACGTGCGCTCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCTGGGCACCCCTGTTCCTGCTGCGCTCCGCCCTGGCCGACTTCAGCCTGGACAACGAGGTGCACTCGAGCTTCATCCACCGGCGCCTCCGCAGCCAGGAGCGGCGGGAGATGCAGCGCGAGATCCTCTCCATTTTGGGCTTGCCCCACCGCCCGCGCCCGCACCTCCAGGGCAAGCACAACTCGGCACCCATGTTCATGCTGGACCTGTACAACGCCATGGCGGTGGAGGAGGGCGGCGGGCCCGGCGGCCAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGCCCCCCTCTGGCCAGCCTGCAAGATAGCCATTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTCGTGGAACATGACAAGGAATTCTTCCACCCACGCTACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATCCCAGAAGGGGAAGCTGTCACGGCAGCCGAATTCCGGATCTACAAGGACTACATCCGGGAACGCTTCGACAATGAGACGTTCCGGATCAGCGTTTATCAGGTGCTCCAGGAGCACTTGGGCAGGGAATCGGATCTCTTCCTGCTCGACAGCCGTACCCTCTGGGCCTCGGAGGAGGGCTGGCTGGTGTTTGACATCACAGCCACCAGCAACCACTGGGTGGTCAATCCGCGGCACAACCTGGGCCTGCAGCTCTCGGTGGAGACGCTGGATGGGCAGAGCATCAACCCCAAGTTGGCGGGCCTGATTGGGCGGCACGGGCCCCAGAACAAGCAGCCCTTCATGGTGGCTTTCTTCAAGGCCACGGAGGTCCACTTCCGCAGCATCCGGTCCACGGGGAGCAAACAGCGCAGCCAGAACCGCTCCAAGACGCCCAAGAACCAGGAAGCCCTGCGGATGGCCAACGTGGCAGAGAACAGCAGCAGCGACCAGAGGCAGGCCTGTAAGAAGCACGAGCTGTATGTCAGCTTCCGAGACCTGGGCTGGCAGGACTGGATCATCGCGCCTGAAGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAG
ORF Protein Sequence MHVRSLRAAAPHSFVALWAPLFLLRSALADFSLDNEVHSSFIHRRLRSQERREMQREILSILGLPHRPRPHLQGKHNSAPMFMLDLYNAMAVEEGGGPGGQGFSYPYKAVFSTQGPPLASLQDSHFLTDADMVMSFVNLVEHDKEFFHPRYHHREFRFDLSKIPEGEAVTAAEFRIYKDYIRERFDNETFRISVYQVLQEHLGRESDLFLLDSRTLWASEEGWLVFDITATSNHWVVNPRHNLGLQLSVETLDGQSINPKLAGLIGRHGPQNKQPFMVAFFKATEVHFRSIRSTGSKQRSQNRSKTPKNQEALRMANVAENSSSDQRQACKKHELYVSFRDLGWQDWIIAPEGYAAYYCEGECAFPLNSYMNATNHAIVQTLVHFINPETVPKPCCAPTQLNAISVLYFDDSSNVILKKYRNMVVRACGCH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T50289-Ab Anti-BMP7/ OP-1 functional antibody
    Target Antigen GM-Tg-g-T50289-Ag BMP7 protein
    Cytokine cks-Tg-g-GM-T50289 bone morphogenetic protein 7 (BMP7) protein & antibody
    ORF Viral Vector pGMLV000318 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMLV000319 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMAAV000461 Human BMP7 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000439 Human BMP7 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-070 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-210 Human BMP7 Adenovirus plasmid
    ORF Viral Vector vGMLV000318 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMLV000319 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMAAV000461 Human BMP7 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000439 Human BMP7 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-070 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-210 Human BMP7 Adenovirus particle


    Target information

    Target ID GM-T50289
    Target Name BMP-7/BMP7
    Gene Group Identifier
    (Target Gene ID in Homo species)
    655
    Gene ID 100050299 (Equus caballus), 101094168 (Felis catus), 12162 (Mus musculus), 477270 (Canis lupus familiaris)
    540595 (Bos taurus), 655 (Homo sapiens), 696948 (Macaca mulatta), 85272 (Rattus norvegicus)
    Gene Symbols & Synonyms BMP7,Bmp7,OP1,OP-1,BMP-7
    Target Alternative Names BMP-7,BMP7,Bmp7,Bone morphogenetic protein 7,OP-1,OP1,Osteogenic protein 1 (OP-1)
    Uniprot Accession P18075,P23359,P34819
    Additional SwissProt Accessions: P23359,P34819,P18075
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease cancer
    Disease from KEGG Cytokine-cytokine receptor interaction, TGF-beta signaling pathway, Axon guidance, Hippo signaling pathway
    Gene Ensembl ENSECAG00000002918, ENSMUSG00000008999, ENSCAFG00845029691, ENSBTAG00000015362, ENSG00000101144, ENSMMUG00000004074
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.