Human MRAP/B27/C21orf61 ORF/cDNA clone-Adenovirus particle (BC062721)

Cat. No.: vGMAP000279

Pre-made Human MRAP/B27/C21orf61 Adenovirus for MRAP overexpression in-vitro and in-vivo. The MRAP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MRAP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to MRAP/B27 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000279 Human MRAP Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000279
Gene Name MRAP
Accession Number BC062721
Gene ID 56246
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 519 bp
Gene Alias B27,C21orf61,FALP
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCAACGGGACCAACGCCTCTGCCCCATACTACAGCTATGAATACTACCTGGACTATCTGGACCTCATTCCCGTGGACGAGAAGAAGCTGAAAGCCCACAAACATTCCATCGTGATCGCATTCTGGGTTAGCCTGGCTGCCTTCGTGGTGCTGCTCTTCCTCATCTTGCTCTACATGTCCTGGTCCGCCTCCCCGCAGATGAGGAACAGCCCCAAGCACCACCAAACATGCCCCTGGAGTCACGGCCTCAACCTCCACCTCTGCATCCAGAAGTGCCTGCCGTGCCACAGGGAACCCCTGGCAACCTCACAGGCTCAGGCGAGCTCAGTGGAGCCAGGGAGCAGAACTGGCCCTGACCAGCCGCTACGACAGGAGAGCTCCTCCACGTTGCCCCTCGGGGGTTTCCAGACCCACCCCACTCTCCTCTGGGAACTGACCCTCAATGGGGGTCCCCTCGTCAGGAGCAAGCCCAGCGAGCCTCCCCCTGGAGACAGGACCTCTCAATTGCAGAGCTGA
ORF Protein Sequence MANGTNASAPYYSYEYYLDYLDLIPVDEKKLKAHKHSIVIAFWVSLAAFVVLLFLILLYMSWSASPQMRNSPKHHQTCPWSHGLNLHLCIQKCLPCHREPLATSQAQASSVEPGSRTGPDQPLRQESSSTLPLGGFQTHPTLLWELTLNGGPLVRSKPSEPPPGDRTSQLQS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0828-Ab Anti-MRAP/ B27/ C21orf61 monoclonal antibody
    Target Antigen GM-Tg-g-MP0828-Ag MRAP VLP (virus-like particle)
    ORF Viral Vector pGMLP000034 Human MRAP Lentivirus plasmid
    ORF Viral Vector pGMAP000279 Human MRAP Adenovirus plasmid
    ORF Viral Vector vGMLP000034 Human MRAP Lentivirus particle
    ORF Viral Vector vGMAP000279 Human MRAP Adenovirus particle


    Target information

    Target ID GM-MP0828
    Target Name MRAP
    Gene Group Identifier
    （Target Gene ID in Homo species)         		56246
    Gene ID 100063927 (Equus caballus), 101093795 (Felis catus), 288271 (Rattus norvegicus), 505743 (Bos taurus)
    56246 (Homo sapiens), 609708 (Canis lupus familiaris), 701330 (Macaca mulatta), 77037 (Mus musculus)
    Gene Symbols & Synonyms MRAP,Mrap,RGD1310648,B27,FALP,FGD2,GCCD2,MRAP1,C21orf61,Falp,ORF61,C21ORF61,1110025G12Rik
    Target Alternative Names 1110025G12Rik,B27,C21ORF61,C21orf61,FALP,FGD2,Falp,Fat cell-specific low molecular weight protein,Fat tissue-specific low MW protein,GCCD2,MRAP,MRAP1,Melanocortin-2 receptor accessory protein,Mrap,ORF61,RGD1310648
    Uniprot Accession Q8TCY5,Q9D159
    Additional SwissProt Accessions: Q8TCY5,Q9D159
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease
    Disease from KEGG Cortisol synthesis and secretion, Cushing syndrome
    Gene Ensembl ENSECAG00000012808, ENSBTAG00000023718, ENSG00000170262, ENSMMUG00000059677, ENSMUSG00000039956
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.