Human BSG/5F7/CD147 ORF/cDNA clone-Adenovirus particle (BC009040)

Cat. No.: vGMAP000243

Pre-made Human BSG/5F7/CD147 Adenovirus for BSG overexpression in-vitro and in-vivo. The BSG adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BSG-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to CD147/BSG/BSG/5F7 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000243 Human BSG Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000243
Gene Name BSG
Accession Number BC009040
Gene ID 682
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 810 bp
Gene Alias 5F7,CD147,EMMPRIN,M6,TCSF
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCGGCTGCGCTGTTCGTGCTGCTGGGATTCGCGCTGCTGGGCACCCACGGAGCCTCCGGGGCTGCCGGCACAGTCTTCACTACCGTAGAAGACCTTGGCTCCAAGATACTCCTCACCTGCTCCTTGAATGACAGCGCCACAGAGGTCACAGGGCACCGCTGGCTGAAGGGGGGCGTGGTGCTGAAGGAGGATGCGCTGCCCGGCCAGAAAACGGAGTTCAAGGTGGACTCGGACGACCAGTGGGGAGAGTACTCCTGCGTCTTCCTCCCCGAGCCCATGGGCACGGCCAACATCCAGCTCCACGGGCCTCCCAGAGTGAAGGCTGTGAAGTCGTCAGAACACATCAACGAGGGGGAGACGGCCATGCTGGTCTGCAAGTCAGAGTCCGTGCCACCTGTCACTGACTGGGCCTGGTACAAGATCACTGACTCTGAGGACAAGGCCCTCATGAACGGCTCCGAGAGCAGGTTCTTCGTGAGTTCCTCGCAGGGCCGGTCAGAGCTACACATTGAGAACCTGAACATGGAGGCCGACCCCGGCCAGTACCGGTGCAACGGCACCAGCTCCAAGGGCTCCGACCAGGCCATCATCACGCTCCGCGTGCGCAGCCACCTGGCCGCCCTCTGGCCCTTCCTGGGCATCGTGGCTGAGGTGCTGGTGCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGA
ORF Protein Sequence MAAALFVLLGFALLGTHGASGAAGTVFTTVEDLGSKILLTCSLNDSATEVTGHRWLKGGVVLKEDALPGQKTEFKVDSDDQWGEYSCVFLPEPMGTANIQLHGPPRVKAVKSSEHINEGETAMLVCKSESVPPVTDWAWYKITDSEDKALMNGSESRFFVSSSQGRSELHIENLNMEADPGQYRCNGTSSKGSDQAIITLRVRSHLAALWPFLGIVAEVLVLVTIIFIYEKRRKPEDVLDDDDAGSAPLKSSGQHQNDKGKNVRQRNSS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-1059 Pre-Made Ziralimumab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody
    Biosimilar GMP-Bios-INN-853 Pre-Made Gavilimomab Biosimilar, Whole Mab, Anti-Bsg Antibody: Anti-5F7/CD147/EMMPRIN/EMPRIN/HAb18G/OK/TCSF therapeutic antibody
    Target Antibody GM-Tg-g-T35040-Ab Anti-BASI/ BSG/ 5F7 monoclonal antibody
    Target Antigen GM-Tg-g-T35040-Ag BSG VLP (virus-like particle)
    ORF Viral Vector pGMLV002088 Human BSG Lentivirus plasmid
    ORF Viral Vector pGMAP000243 Human BSG Adenovirus plasmid
    ORF Viral Vector pGMPC001016 Human BSG Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002088 Human BSG Lentivirus particle
    ORF Viral Vector vGMAP000243 Human BSG Adenovirus particle


    Target information

    Target ID GM-T35040
    Target Name CD147/BSG
    Gene Group Identifier
    (Target Gene ID in Homo species)
    682
    Gene ID 100049616 (Equus caballus), 101090746 (Felis catus), 12215 (Mus musculus), 25246 (Rattus norvegicus)
    476758 (Canis lupus familiaris), 508716 (Bos taurus), 682 (Homo sapiens), 721068 (Macaca mulatta)
    Gene Symbols & Synonyms BSG,Bsg,CD147,HT-7,EMMPRIN,CE9,HT7,5A11,Ox47R,basignin,RPE7,OK,5F7,TCSF,EMPRIN,HAb18G
    Target Alternative Names 5A11,5F7,BSG,Basigin,Bsg,CD147,CE9,Collagenase stimulatory factor,EMMPRIN,EMPRIN,Extracellular matrix metalloproteinase inducer (EMMPRIN),HAb18G,HT-7,HT7,Hepatoma-associated antigen (HAb18G),Leukocyte activation antigen M6,OK,OK blood group antigen,Ox47R,RPE7,TCSF,Tumor cell-derived collagenase stimulatory factor (TCSF),basignin
    Uniprot Accession P18572,P26453,P35613
    Additional SwissProt Accessions: P18572,P26453,P35613
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Urinary bladder urothelial carcinoma
    Disease from KEGG
    Gene Ensembl ENSMUSG00000023175, ENSCAFG00845015138, ENSBTAG00000016648, ENSG00000172270, ENSMMUG00000018740
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.