Human GJA1/CX43/DFNB38 ORF/cDNA clone-Adenovirus particle (BC026329)

Cat. No.: vGMAP000184

Pre-made Human GJA1/CX43/DFNB38 Adenovirus for GJA1 overexpression in-vitro and in-vivo. The GJA1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GJA1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to Connexin 43/GJA1/GJA1/CX43 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000184 Human GJA1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000184
Gene Name GJA1
Accession Number BC026329
Gene ID 2697
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1149 bp
Gene Alias CX43,DFNB38
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGGGACAGCGGTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGTTGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTCATGTGCGCTTCTGGGTCCTGCAGATCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCATGTGTTCTATGTGATGCGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACTGATGGTGTCAATGTGGACATGCACTTGAAGCAGATTGAGATAAAGAAGTTCAAGTACGGTATTGAAGAGCATGGTAAGGTGAAAATGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTCTTCAAGTCTATCTTTGAGGTGGCCTTCTTGCTGATCCAGTGGTACATCTATGGATTCAGCTTGAGTGCTGTTTACACTTGCAAAAGAGATCCCTGCCCACATCAGGTGGACTGTTTCCTCTCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCCCTGGCCTTGAATATCATTGAACTCTTCTATGTTTTCTTCAAGGGCGTTAAGGATCGGGTTAAGGGAAAGAGCGACCCTTACCATGCGACCAGTGGTGCGCTGAGCCCTGCCAAAGACTGTGGGTCTCAAAAATATGCTTATTTCAATGGCTGCTCCTCACCAACCGCTCCCCTCTCGCCTATGTCTCCTCCTGGGTACAAGCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAATTACAACAAGCAAGCAAGTGAGCAAAACTGGGCTAATTACAGTGCAGAACAAAATCGAATGGGGCAGGCGGGAAGCACCATCTCTAACTCCCATGCACAGCCTTTTGATTTCCCCGATGATAACCAGAATTCAAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGCCATTGTGGACCAGCGACCTTCAAGCAGAGCCAGCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTGGAGATCTAG
ORF Protein Sequence MGDWSALGKLLDKVQAYSTAGGKVWLSVLFIFRILLLGTAVESAWGDEQSAFRCNTQQPGCENVCYDKSFPISHVRFWVLQIIFVSVPTLLYLAHVFYVMRKEEKLNKKEEELKVAQTDGVNVDMHLKQIEIKKFKYGIEEHGKVKMRGGLLRTYIISILFKSIFEVAFLLIQWYIYGFSLSAVYTCKRDPCPHQVDCFLSRPTEKTIFIIFMLVVSLVSLALNIIELFYVFFKGVKDRVKGKSDPYHATSGALSPAKDCGSQKYAYFNGCSSPTAPLSPMSPPGYKLVTGDRNNSSCRNYNKQASEQNWANYSAEQNRMGQAGSTISNSHAQPFDFPDDNQNSKKLAAGHELQPLAIVDQRPSSRASSRASSRPRPDDLEI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T44479-Ab Anti-CXA1/ GJA1/ AVSD3 monoclonal antibody
    Target Antigen GM-Tg-g-T44479-Ag GJA1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001348 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMLV000455 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMLV001053 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMLV001055 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMLV002512 Human GJA1 Lentivirus plasmid
    ORF Viral Vector pGMAD001175 Human GJA1 Adenovirus plasmid
    ORF Viral Vector pGMAP000184 Human GJA1 Adenovirus plasmid
    ORF Viral Vector vGMLP001348 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMLV000455 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMLV001053 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMLV001055 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMLV002512 Human GJA1 Lentivirus particle
    ORF Viral Vector vGMAD001175 Human GJA1 Adenovirus particle
    ORF Viral Vector vGMAP000184 Human GJA1 Adenovirus particle


    Target information

    Target ID GM-T44479
    Target Name Connexin 43/GJA1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2697
    Gene ID 100067229 (Equus caballus), 101100211 (Felis catus), 14609 (Mus musculus), 24392 (Rattus norvegicus)
    2697 (Homo sapiens), 281193 (Bos taurus), 403418 (Canis lupus familiaris), 714344 (Macaca mulatta)
    Gene Symbols & Synonyms GJA1,Gja1,CX43,CXNK1,Cx43,Npm1,Cnx43,Cxnk1,Gja-1,Cx43alpha1,connexin43,HSS,CMDR,EKVP,GJAL,ODDD,AVSD3,EKVP3,HLHS1,PPKCA,cx43
    Target Alternative Names AVSD3,CMDR,CX43,CXNK1,Cnx43,Connexin 43,Connexin-43 (Cx43),Cx43,Cx43alpha1,Cxnk1,EKVP,EKVP3,GJA1,GJAL,Gap junction 43 kDa heart protein,Gap junction alpha-1 protein,Gja-1,Gja1,HLHS1,HSS,Npm1,ODDD,PPKCA,connexin43,cx43
    Uniprot Accession P08050,P17302,P18246,P23242,Q6S9C0
    Additional SwissProt Accessions: P23242,P08050,P17302,P18246,Q6S9C0
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Gap junction, Arrhythmogenic right ventricular cardiomyopathy
    Gene Ensembl ENSECAG00000005525, ENSMUSG00000050953, ENSG00000152661, ENSBTAG00000001835, ENSCAFG00845009132, ENSMMUG00000005225
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.