Human APP/AAA/ABETA ORF/cDNA clone-Adenovirus particle (BC004369)

Cat. No.: vGMAP000180

Pre-made Human APP/AAA/ABETA Adenovirus for APP overexpression in-vitro and in-vivo. The APP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified APP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to APP/Beta Amyloid/APP/AAA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000180 Human APP Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000180
Gene Name APP
Accession Number BC004369
Gene ID 351
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 918 bp
Gene Alias AAA,ABETA,ABPP,APPI,CTFgamma,CVAP,PN2
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGCTGCCCGGTTTGGCACTGCTCCTGCTGGCCGCCTGGACGGCTCGGGCGCTGGAGGTACCCACTGATGGTAATGCTGGCCTGCTGGCTGAACCCCAGATTGCCATGTTCTGTGGCAGACTGAACATGCACATGAATGTCCAGAATGGGAAGTGGGATTCAGATCCATCAGGGACCAAAACCTGCATTGATACCAAGGAAGGCATCCTGCAGTATTGCCAAGAAGTCTACCCTGAACTGCAGATCACCAATGTGGTAGAAGCCAACCAACCAGTGACCATCCAGAACTGGTGCAAGCGGGGCCGCAAGCAGTGCAAGACCCATCCCCACTTTGTGATTCCCTACCGCTGCTTAGTTGGTGAGTTTGTAAGTGATGCCCTTCTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGGATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAGAAGAGTACCAACTTGCATGACTACGGCATGTTGCTGCCCTGCGGAATTGACAAGTTCCGAGGGGTAGAGTTTGTGTGTTGCCCACTGGCTGAAGAAAGTGACAATGTGGATTCTGCTGATGCGGAGGAGGATGACTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGGAGTGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGGTGGAAGAAGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTACGAAGAAGCCACAGAGAGAACCACCAGCATTGCCACCACCACCACCACCACCACAGAGTCTGTGGAAGAGGTGGTTCGAGAGAAGTGGTATAAGGAAGTACATTCTGGCCAGGCACGATGGCTCATGCTGTAA
ORF Protein Sequence MLPGLALLLLAAWTARALEVPTDGNAGLLAEPQIAMFCGRLNMHMNVQNGKWDSDPSGTKTCIDTKEGILQYCQEVYPELQITNVVEANQPVTIQNWCKRGRKQCKTHPHFVIPYRCLVGEFVSDALLVPDKCKFLHQERMDVCETHLHWHTVAKETCSEKSTNLHDYGMLLPCGIDKFRGVEFVCCPLAEESDNVDSADAEEDDSDVWWGGADTDYADGSEDKVVEVAEEEEVAEVEEEEADDDEDDEDGDEVEEEAEEPYEEATERTTSIATTTTTTTESVEEVVREKWYKEVHSGQARWLML

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-011 Pre-Made Aducanumab biosimilar, Whole mAb, Anti-APP Antibody: Anti-AAA/AD1/PN2/ABPP/CVAP/ABETA/PN-II/preA4/CTFgamma therapeutic antibody
    Biosimilar GMP-Bios-ab-527 Pre-Made Solanezumab biosimilar, Whole mAb, Anti-APP Antibody: Anti-AAA/AD1/PN2/ABPP/CVAP/ABETA/PN-II/preA4/CTFgamma therapeutic antibody
    Biosimilar GMP-Bios-ab-232 Pre-Made Gantenerumab biosimilar, Whole mAb, Anti-APP Antibody: Anti-AAA/AD1/PN2/ABPP/CVAP/ABETA/PN-II/preA4/CTFgamma therapeutic antibody
    Biosimilar GMP-Bios-ab-046 Pre-Made Bapineuzumab biosimilar, Whole mAb, Anti-APP Antibody: Anti-AAA/AD1/PN2/ABPP/CVAP/ABETA/PN-II/preA4/CTFgamma therapeutic antibody
    Biosimilar GMP-Bios-ab-450 Pre-Made Ponezumab biosimilar, Whole mAb, Anti-APP Antibody: Anti-AAA/AD1/PN2/ABPP/CVAP/ABETA/PN-II/preA4/CTFgamma therapeutic antibody
    Biosimilar GMP-Bios-ab-153 Pre-Made Donanemab biosimilar, Whole mAb, Anti-APP Antibody: Anti-AAA/AD1/PN2/ABPP/CVAP/ABETA/PN-II/preA4/CTFgamma therapeutic antibody
    Biosimilar GMP-Bios-ab-300 Pre-Made Lecanemab biosimilar, Whole mAb, Anti-APP Antibody: Anti-AAA/AD1/PN2/ABPP/CVAP/ABETA/PN-II/preA4/CTFgamma therapeutic antibody
    Biosimilar GMP-Bios-ab-122 Pre-Made Crenezumab biosimilar, Whole mAb, Anti-APP Antibody: Anti-AAA/AD1/PN2/ABPP/CVAP/ABETA/PN-II/preA4/CTFgamma therapeutic antibody
    Target Antibody GM-Tg-g-T87024-Ab Anti-A4/ APP/ AAA monoclonal antibody
    Target Antigen GM-Tg-g-T87024-Ag APP VLP (virus-like particle)
    ORF Viral Vector pGMLV000006 Human APP Lentivirus plasmid
    ORF Viral Vector pGMLV000448 Human APP Lentivirus plasmid
    ORF Viral Vector pGMLV000767 Human APP Lentivirus plasmid
    ORF Viral Vector pGMLV001205 Human APP Lentivirus plasmid
    ORF Viral Vector pGMLV001236 Human APP Lentivirus plasmid
    ORF Viral Vector pGMAD000012 Human APP Adenovirus plasmid
    ORF Viral Vector pGMAD000406 Human APP Adenovirus plasmid
    ORF Viral Vector pGMAD000683 Human APP Adenovirus plasmid
    ORF Viral Vector pGMAP000180 Human APP Adenovirus plasmid
    ORF Viral Vector vGMLV000006 Human APP Lentivirus particle
    ORF Viral Vector vGMLV000448 Human APP Lentivirus particle
    ORF Viral Vector vGMLV000767 Human APP Lentivirus particle
    ORF Viral Vector vGMLV001205 Human APP Lentivirus particle
    ORF Viral Vector vGMLV001236 Human APP Lentivirus particle
    ORF Viral Vector vGMAD000012 Human APP Adenovirus particle
    ORF Viral Vector vGMAD000406 Human APP Adenovirus particle
    ORF Viral Vector vGMAD000683 Human APP Adenovirus particle
    ORF Viral Vector vGMAP000180 Human APP Adenovirus particle


    Target information

    Target ID GM-T87024
    Target Name APP/Beta Amyloid
    Gene Group Identifier
    (Target Gene ID in Homo species)
    351
    Gene ID 100066294 (Equus caballus), 100427716 (Macaca mulatta), 101085564 (Felis catus), 11820 (Mus musculus)
    280722 (Bos taurus), 351 (Homo sapiens), 403407 (Canis lupus familiaris), 54226 (Rattus norvegicus)
    Gene Symbols & Synonyms APP,App,ABPP,Ag,Abpp,Adap,Cvap,Abeta,betaApp,E030013M08Rik,AAA,AD1,PN2,APPI,CVAP,ABETA,PN-II,preA4,CTFgamma,alpha-sAPP
    Target Alternative Names AAA,ABETA,ABPP,AD1,APP,APPI,Abeta,Abpp,Adap,Ag,Alzheimer disease amyloid A4 protein homolog,Alzheimer disease amyloid protein,Amyloid precursor protein,Amyloid-beta (A4) precursor protein,Amyloid-beta A4 protein,Amyloid-beta precursor protein,App,Beta Amyloid,CTFgamma,CVAP,Cerebral vascular amyloid peptide (CVAP),Cvap,E030013M08Rik,PN-II,PN2,PreA4,Protease nexin-II (PN-II),alpha-sAPP,betaApp,preA4
    Uniprot Accession P05067,P08592,P12023,P29216,P86906,Q28053,Q28280
    Additional SwissProt Accessions: P29216,P86906,P12023,Q28053,P05067,Q28280,P08592
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease
    Disease from KEGG Serotonergic synapse, Alzheimer disease
    Gene Ensembl ENSECAG00000021011, ENSMMUG00000014384, ENSMUSG00000022892, ENSBTAG00000017753, ENSG00000142192, ENSCAFG00845015660
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.