Human FTH1/FTH/PIG15 ORF/cDNA clone-Adenovirus particle (BC000857)
Cat. No.: vGMAP000151
Pre-made Human FTH1/FTH/PIG15 Adenovirus for FTH1 overexpression in-vitro and in-vivo. The FTH1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified FTH1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
Ferritin heavy chain/FTH1/FTH1/FTH products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000151 | Human FTH1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000151 |
| Gene Name | FTH1 |
| Accession Number | BC000857 |
| Gene ID | 2495 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 552 bp |
| Gene Alias | FTH,PIG15,PLIF |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAA |
| ORF Protein Sequence | MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T89873-Ab | Anti-FTH1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T89873-Ag | FTH1 protein |
| ORF Viral Vector | pGMLV000307 | Human FTH1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000308 | Human FTH1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000151 | Human FTH1 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000822 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001052 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV000307 | Human FTH1 Lentivirus particle |
| ORF Viral Vector | vGMLV000308 | Human FTH1 Lentivirus particle |
| ORF Viral Vector | vGMAP000151 | Human FTH1 Adenovirus particle |
Target information
| Target ID | GM-T89873 |
| Target Name | Ferritin heavy chain/FTH1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
2495 |
| Gene ID |
100062811 (Equus caballus), 14319 (Mus musculus), 2495 (Homo sapiens), 25319 (Rattus norvegicus) 281173 (Bos taurus), 403631 (Canis lupus familiaris), 574118 (Macaca mulatta), 654516 (Felis catus) |
| Gene Symbols & Synonyms | FTH1,Fth1,FHC,Fth,HFt,MFH,FTH,HFE5,PLIF,FTHL6,NBIA9,PIG15 |
| Target Alternative Names | Cell proliferation-inducing gene 15 protein,FHC,FTH,FTH1,FTHL6,Ferritin H subunit,Ferritin heavy chain,Fth,Fth1,HFE5,HFt,MFH,NBIA9,PIG15,PLIF |
| Uniprot Accession |
O46414,P02794,P09528,P19132,Q2MHN2,Q8MIP0,Q95MP7
Additional SwissProt Accessions: Q8MIP0,P09528,P02794,P19132,O46414,Q95MP7,Q2MHN2 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | |
| Disease from KEGG | Ferroptosis, Mineral absorption |
| Gene Ensembl | ENSECAG00000008683, ENSMUSG00000024661, ENSG00000167996, ENSBTAG00000011184, ENSCAFG00845010380, ENSMMUG00000015146 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


