Human ICAM1/BB2/CD54 ORF/cDNA clone-Adenovirus particle (BC015969)

Cat. No.: vGMAP000135

Pre-made Human ICAM1/BB2/CD54 Adenovirus for ICAM1 overexpression in-vitro and in-vivo. The ICAM1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified ICAM1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to CD54 /ICAM-1/ICAM1/CD54/ICAM1/BB2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000135 Human ICAM1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000135
Gene Name ICAM1
Accession Number BC015969
Gene ID 3383
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1599 bp
Gene Alias BB2,CD54,P3.58
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCTCCCAGCAGCCCCCGGCCCGCGCTGCCCGCACTCCTGGTCCTGCTCGGGGCTCTGTTCCCAGGACCTGGCAATGCCCAGACATCTGTGTCCCCCTCAAAAGTCATCCTGCCCCGGGGAGGCTCCGTGCTGGTGACATGCAGCACCTCCTGTGACCAGCCCAAGTTGTTGGGCATAGAGACCCCGTTGCCTAAAAAGGAGTTGCTCCTGCCTGGGAACAACCGGAAGGTGTATGAACTGAGCAATGTGCAAGAAGATAGCCAACCAATGTGCTATTCAAACTGCCCTGATGGGCAGTCAACAGCTAAAACCTTCCTCACCGTGTACTGGACTCCAGAACGGGTGGAACTGGCACCCCTCCCCTCTTGGCAGCCAGTGGGCAAGAACCTTACCCTACGCTGCCAGGTGGAGGGTGGGGCACCCCGGGCCAACCTCACCGTGGTGCTGCTCCGTGGGGAGAAGGAGCTGAAACGGGAGCCAGCTGTGGGGGAGCCCGCTGAGGTCACGACCACGGTGCTGGTGAGGAGAGATCACCATGGAGCCAATTTCTCGTGCCGCACTGAACTGGACCTGCGGCCCCAAGGGCTGGAGCTGTTTGAGAACACCTCGGCCCCCTACCAGCTCCAGACCTTTGTCCTGCCAGCGACTCCCCCACAACTTGTCAGCCCCCGGGTCCTAGAGGTGGACACGCAGGGGACCGTGGTCTGTTCCCTGGACGGGCTGTTCCCAGTCTCGGAGGCCCAGGTCCACCTGGCACTGGGGGACCAGAGGTTGAACCCCACAGTCACCTATGGCAACGACTCCTTCTCGGCCAAGGCCTCAGTCAGTGTGACCGCAGAGGACGAGGGCACCCAGCGGCTGACGTGTGCAGTAATACTGGGGAACCAGAGCCAGGAGACACTGCAGACAGTGACCATCTACAGCTTTCCGGCGCCCAACGTGATTCTGACGAAGCCAGAGGTCTCAGAAGGGACCGAGGTGACAGTGAAGTGTGAGGCCCACCCTAGAGCCAAGGTGACGCTGAATGGGGTTCCAGCCCAGCCACTGGGCCCGAGGGCCCAGCTCCTGCTGAAGGCCACCCCAGAGGACAACGGGCGCAGCTTCTCCTGCTCTGCAACCCTGGAGGTGGCCGGCCAGCTTATACACAAGAACCAGACCCGGGAGCTTCGTGTCCTGTATGGCCCCCGACTGGACGAGAGGGATTGTCCGGGAAACTGGACGTGGCCAGAAAATTCCCAGCAGACTCCAATGTGCCAGGCTTGGGGGAACCCATTGCCCGAGCTCAAGTGTCTAAAGGATGGCACTTTCCCACTGCCCATCGGGGAATCAGTGACTGTCACTCGAGATCTTGAGGGCACCTACCTCTGTCGGGCCAGGAGCACTCAAGGGGAGGTCACCCGCAAGGTGACCGTGAATGTGCTCTCCCCCCGGTATGAGATTGTCATCATCACTGTGGTAGCAGCCGCAGTCATAATGGGCACTGCAGGCCTCAGCACGTACCTCTATAACCGCCAGCGGAAGATCAAGAAATACAGACTACAACAGGCCCAAAAAGGGACCCCCATGAAACCGAACACACAAGCCACGCCTCCCTGA
ORF Protein Sequence MAPSSPRPALPALLVLLGALFPGPGNAQTSVSPSKVILPRGGSVLVTCSTSCDQPKLLGIETPLPKKELLLPGNNRKVYELSNVQEDSQPMCYSNCPDGQSTAKTFLTVYWTPERVELAPLPSWQPVGKNLTLRCQVEGGAPRANLTVVLLRGEKELKREPAVGEPAEVTTTVLVRRDHHGANFSCRTELDLRPQGLELFENTSAPYQLQTFVLPATPPQLVSPRVLEVDTQGTVVCSLDGLFPVSEAQVHLALGDQRLNPTVTYGNDSFSAKASVSVTAEDEGTQRLTCAVILGNQSQETLQTVTIYSFPAPNVILTKPEVSEGTEVTVKCEAHPRAKVTLNGVPAQPLGPRAQLLLKATPEDNGRSFSCSATLEVAGQLIHKNQTRELRVLYGPRLDERDCPGNWTWPENSQQTPMCQAWGNPLPELKCLKDGTFPLPIGESVTVTRDLEGTYLCRARSTQGEVTRKVTVNVLSPRYEIVIITVVAAAVIMGTAGLSTYLYNRQRKIKKYRLQQAQKGTPMKPNTQATPP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-835
    Biosimilar GMP-Bios-INN-834 Pre-Made Enlimomab Biosimilar, Whole Mab, Anti-ICAM1 Antibody: Anti-BB2/CD54/P3.58 therapeutic antibody
    Biosimilar GMP-Bios-ab-064 Pre-Made Bersanlimab biosimilar, Whole mAb, Anti-ICAM1 Antibody: Anti-BB2/CD54/P3.58 therapeutic antibody
    Target Antibody GM-Tg-g-T26203-Ab Anti-ICAM1/ BB2/ CD54 monoclonal antibody
    Target Antigen GM-Tg-g-T26203-Ag ICAM1 VLP (virus-like particle)
    ORF Viral Vector pGMAP000135 Human ICAM1 Adenovirus plasmid
    ORF Viral Vector pGMPC000278 Human ICAM1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMAP000135 Human ICAM1 Adenovirus particle


    Target information

    Target ID GM-T26203
    Target Name CD54 /ICAM-1/ICAM1/CD54
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3383
    Gene ID 100058207 (Equus caballus), 101089421 (Felis catus), 15894 (Mus musculus), 25464 (Rattus norvegicus)
    3383 (Homo sapiens), 403975 (Canis lupus familiaris), 712280 (Macaca mulatta)
    Gene Symbols & Synonyms ICAM1,Icam1,CD54,Ly-47,Icam-1,MALA-2,ICAM,BB2,P3.58,ICAM-1
    Target Alternative Names BB2,CD54,ICAM,ICAM-1,ICAM1,Icam-1,Icam1,Intercellular adhesion molecule 1,Ly-47,MALA-2,Major group rhinovirus receptor,P3.58
    Uniprot Accession P05362,P13597,P33729,Q00238,Q5NKV6
    Additional SwissProt Accessions: P13597,Q00238,P05362,P33729,Q5NKV6
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease cancer, Pancreas Cancer, asthma, Inflammation, Thrombosis, Chronic Kidney Disease, Kidney transplant rejection, Lupus Glomerulonephritis, Systemic lupus erythematosus (SLE), breast cancer
    Disease from KEGG NF-kappa B signaling pathway, Cell adhesion molecules, Natural killer cell mediated cytotoxicity, TNF signaling pathway, Leukocyte transendothelial migration, AGE-RAGE signaling pathway in diabetic complications, African trypanosomiasis, Malaria, Staphylococcus aureus infection, Influenza A, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Rheumatoid arthritis, Viral myocarditis, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis
    Gene Ensembl ENSECAG00000013883, ENSMUSG00000037405, ENSG00000090339, ENSCAFG00845027986, ENSMMUG00000014896
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.