Human GAD1 ORF/cDNA clone-Adenovirus particle (BC002815)
Cat. No.: vGMAP000105
Pre-made Human GAD1/ Adenovirus for GAD1 overexpression in-vitro and in-vivo. The GAD1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GAD1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
GAD1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000105 | Human GAD1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000105 |
| Gene Name | GAD1 |
| Accession Number | BC002815 |
| Gene ID | 2571 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 675 bp |
| Gene Alias | |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGCGTCTTCGACCCCATCTTCGTCCGCAACCTCCTCGAACGCGGGAGCGGACCCCAATACCACTAACCTGCGCCCCACAACGTACGATACCTGGTGCGGCGTGGCCCATGGATGCACCAGAAAACTGGGGCTCAAGATCTGCGGCTTCTTGCAAAGGACCAACAGCCTGGAAGAGAAGAGTCGCCTTGTGAGTGCCTTCAAGGAGAGGCAATCCTCCAAGAACCTGCTTTCCTGTGAAAACAGCGACCGGGATGCCCGCTTCCGGCGCACAGAGACTGACTTCTCTAATCTGTTTGCTAGAGATCTGCTTCCGGCTAAGAACGGTGAGGAGCAAACCGTGCAATTCCTCCTGGAAGTGGTGGACATACTCCTCAACTATGTCCGCAAGACATTTGATCGCTCCACCAAGGTGCTGGACTTTCATCACCCACACCAGTTGCTGGAAGGCATGGAGGGCTTCAACTTGGAGCTCTCTGACCACCCCGAGTCCCTGGAGCAGATCCTGGTTGACTGCAGAGACACCTTGAAGTATGGGGTTCGCACAGGTCATCCTCGATTTTTCAACCAGCTCTCCACTGGATTGGATATTATTGGCCTAGCTGGAGAATGGCTGACATCAACGGCCAATACCAACATGCCATCAGACATGAGGGAGTGTTGGTTGCTACGGTGA |
| ORF Protein Sequence | MASSTPSSSATSSNAGADPNTTNLRPTTYDTWCGVAHGCTRKLGLKICGFLQRTNSLEEKSRLVSAFKERQSSKNLLSCENSDRDARFRRTETDFSNLFARDLLPAKNGEEQTVQFLLEVVDILLNYVRKTFDRSTKVLDFHHPHQLLEGMEGFNLELSDHPESLEQILVDCRDTLKYGVRTGHPRFFNQLSTGLDIIGLAGEWLTSTANTNMPSDMRECWLLR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T26900-Ab | Anti-GAD1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T26900-Ag | GAD1 protein |
| ORF Viral Vector | pGMAP000105 | Human GAD1 Adenovirus plasmid |
| ORF Viral Vector | vGMAP000105 | Human GAD1 Adenovirus particle |
Target information
| Target ID | GM-T26900 |
| Target Name | GAD1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
2571 |
| Gene ID |
100052860 (Equus caballus), 14415 (Mus musculus), 24379 (Rattus norvegicus), 2571 (Homo sapiens) 478794 (Canis lupus familiaris), 493699 (Felis catus), 517552 (Bos taurus), 613030 (Macaca mulatta) |
| Gene Symbols & Synonyms | GAD1,Gad1,EP10,Gad-1,Gad67,GAD,SCP,CPSQ1,DEE89,GAD67 |
| Target Alternative Names | 67 kDa glutamic acid decarboxylase (GAD-67),CPSQ1,DEE89,EP10,GAD,GAD1,GAD67,Gad-1,Gad1,Gad67,Glutamate decarboxylase 1,Glutamate decarboxylase 67 kDa isoform,SCP |
| Uniprot Accession |
A0PA85,P14748,P18088,P48318,Q0VCA1,Q99259
Additional SwissProt Accessions: P48318,P18088,Q99259,A0PA85,P14748,Q0VCA1 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | |
| Disease from KEGG | Metabolic pathways, GABAergic synapse, Type I diabetes mellitus |
| Gene Ensembl | ENSECAG00000012405, ENSMUSG00000070880, ENSG00000128683, ENSCAFG00845025996, ENSBTAG00000007258, ENSMMUG00000015198 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


