Human BCL2L1/Bcl-X/bcl-xL ORF/cDNA clone-Adenovirus particle (BC019307)

Cat. No.: vGMAP000056

Pre-made Human BCL2L1/Bcl-X/bcl-xL Adenovirus for BCL2L1 overexpression in-vitro and in-vivo. The BCL2L1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BCL2L1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to Bcl-XL/Bcl-xL/BCL2L1/BCL-xL/BCL2L1/Bcl-X products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000056 Human BCL2L1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000056
Gene Name BCL2L1
Accession Number BC019307
Gene ID 598
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 702 bp
Gene Alias Bcl-X,bcl-xL,BCL-XL/S,bcl-xS,BCL2L,BCLX
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTTAGTGATGTGGAAGAGAACAGGACTGAGGCCCCAGAAGGGACTGAATCGGAGATGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCAGACAGCCCCGCGGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCCCGGGAGGTGATCCCCATGGCAGCAGTAAAGCAAGCGCTGAGGGAGGCAGGCGACGAGTTTGAACTGCGGTACCGGCGGGCATTCAGTGACCTGACATCCCAGCTCCACATCACCCCAGGGACAGCATATCAGAGCTTTGAACAGGTAGTGAATGAACTCTTCCGGGATGGGGTAAACTGGGGTCGCATTGTGGCCTTTTTCTCCTTCGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGAGTCGGATCGCAGCTTGGATGGCCACTTACCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGGCTGGGATACTTTTGTGGAACTCTATGGGAACAATGCAGCAGCCGAGAGCCGAAAGGGCCAGGAACGCTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCCGGCGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAATGA
ORF Protein Sequence MSQSNRELVVDFLSYKLSQKGYSWSQFSDVEENRTEAPEGTESEMETPSAINGNPSWHLADSPAVNGATGHSSSLDAREVIPMAAVKQALREAGDEFELRYRRAFSDLTSQLHITPGTAYQSFEQVVNELFRDGVNWGRIVAFFSFGGALCVESVDKEMQVLVSRIAAWMATYLNDHLEPWIQENGGWDTFVELYGNNAAAESRKGQERFNRWFLTGMTVAGVVLLGSLFSRK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0048-Ab Anti-BCL-xL monoclonal antibody
    Target Antigen GM-Tg-g-IP0048-Ag BCL-xL/BCL2L1 protein
    ORF Viral Vector pGMLP000494 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMLP005610 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMLP005822 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMAP000056 Human BCL2L1 Adenovirus plasmid
    ORF Viral Vector pGMPC001115 Human BCL2L1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000494 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMLP005610 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMLP005822 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMAP000056 Human BCL2L1 Adenovirus particle


    Target information

    Target ID GM-IP0048
    Target Name Bcl-XL/Bcl-xL/BCL2L1/BCL-xL
    Gene Group Identifier
    （Target Gene ID in Homo species)         		598
    Gene ID 100053597 (Equus caballus), 12048 (Mus musculus), 24888 (Rattus norvegicus), 282152 (Bos taurus)
    403618 (Canis lupus familiaris), 493701 (Felis catus), 598 (Homo sapiens), 713035 (Macaca mulatta)
    Gene Symbols & Synonyms BCL2L1,Bcl2l1,BclX,Bcl2l,bcl-x,Bcl-XL,Bcl(X)L,bcl2-L-1,Bclx,bcl-X,Bcl-xl,BCLX,Bcl-xL,BCL-XL,bcl-xl,BCL2L,Bcl-X,PPP1R52,BCL-XL/S
    Target Alternative Names Apoptosis regulator Bcl-X,BCL-XL,BCL-XL/S,BCL-xL,BCL2L,BCL2L1,BCLX,Bcl(X)L,Bcl-2-like protein 1,Bcl-X,Bcl-XL,Bcl-xL,Bcl-xl,Bcl2-L-1,Bcl2l,Bcl2l1,BclX,Bclx,PPP1R52,bcl-X,bcl-x,bcl-xl,bcl2-L-1
    Uniprot Accession P53563,Q07817,Q64373
    Additional SwissProt Accessions: Q64373,P53563,Q07817
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG EGFR tyrosine kinase inhibitor resistance, Ras signaling pathway, NF-kappa B signaling pathway, p53 signaling pathway, PI3K-Akt signaling pathway, Apoptosis, Apoptosis - multiple species, NOD-like receptor signaling pathway, JAK-STAT signaling pathway, Toxoplasmosis, Measles, Human T-cell leukemia virus 1 infection, Pathways in cancer, Pancreatic cancer, Chronic myeloid leukemia, Small cell lung cancer, Hepatocellular carcinoma, Lipid and atherosclerosis
    Gene Ensembl ENSECAG00000017223, ENSMUSG00000007659, ENSBTAG00000006526, ENSCAFG00845018778, ENSG00000171552, ENSMMUG00000005985
    Target Classification Pathway, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.