Human INS ORF/cDNA clone-Adenovirus particle (BC005255)
Cat. No.: vGMAP000054
Pre-made Human INS/ Adenovirus for INS overexpression in-vitro and in-vivo. The INS adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified INS-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
INS products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000054 | Human INS Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000054 |
| Gene Name | INS |
| Accession Number | BC005255 |
| Gene ID | 3630 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 333 bp |
| Gene Alias | |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG |
| ORF Protein Sequence | MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T82841-Ab | Anti-INS/ IDDM/ IDDM1 functional antibody |
| Target Antigen | GM-Tg-g-T82841-Ag | INS protein |
| ORF Viral Vector | pGMAP000054 | Human INS Adenovirus plasmid |
| ORF Viral Vector | vGMAP000054 | Human INS Adenovirus particle |
Target information
| Target ID | GM-T82841 |
| Target Name | INS |
|
Gene Group Identifier (Target Gene ID in Homo species) |
3630 |
| Gene ID |
111776000 (Equus caballus), 16334 (Mus musculus), 24506 (Rattus norvegicus), 280829 (Bos taurus) 3630 (Homo sapiens), 483665 (Canis lupus familiaris), 493804 (Felis catus), 704534 (Macaca mulatta) |
| Gene Symbols & Synonyms | INS,Ins2,Mody,Ins-2,InsII,Mody4,CP-II,IDDM,ILPR,IRDN,IDDM1,IDDM2,PNDM4,MODY10 |
| Target Alternative Names | CP-II,IDDM,IDDM1,IDDM2,ILPR,INS,IRDN,Ins-2,Ins2,InsII,Insulin,MODY10,Mody,Mody4,PNDM4 |
| Uniprot Accession |
P01308,P01310,P01317,P01321,P01323,P01326,P06306
Additional SwissProt Accessions: P01310,P01326,P01323,P01317,P01308,P01321,P06306 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Diagnostics Biomarker |
| Disease | |
| Disease from KEGG | MAPK signaling pathway, Ras signaling pathway, Rap1 signaling pathway, cGMP-PKG signaling pathway, HIF-1 signaling pathway, FoxO signaling pathway, Phospholipase D signaling pathway, PI3K-Akt signaling pathway, Longevity regulating pathway, Longevity regulating pathway - multiple species, Regulation of actin cytoskeleton, Insulin secretion, Ovarian steroidogenesis, Prolactin signaling pathway, Regulation of lipolysis in adipocytes, Type II diabetes mellitus, Insulin resistance, Type I diabetes mellitus, Aldosterone-regulated sodium reabsorption, Alzheimer disease, Prostate cancer |
| Gene Ensembl | ENSMUSG00000000215, ENSBTAG00000013003, ENSG00000254647, ENSCAFG00845011141, ENSMMUG00000031267 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


