Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human C5AR1/C5A/C5AR ORF/cDNA clone-Adenovirus particle (BC008982)
Cat. No.: vGMAP000035
Pre-made Human C5AR1/C5A/C5AR Adenovirus for C5AR1 overexpression in-vitro and in-vivo. The C5AR1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified C5AR1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
C5aR/C5AR1/CD88/C5AR1/C5A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000035 | Human C5AR1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000035 |
| Gene Name | C5AR1 |
| Accession Number | BC008982 |
| Gene ID | 728 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1053 bp |
| Gene Alias | C5A,C5AR,CD88 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGAACTCCTTCAATTATACCACCCCTGATTATGGGCACTATGATGACAAGGATACCCTGGACCTCAACACCCCTGTGGATAAAACTTCTAACACGCTGCGTGTTCCAGACATCCTGGCCTTGGTCATCTTTGCAGTCGTCTTCCTGGTGGGAGTGCTGGGCAATGCCCTGGTGGTCTGGGTGACGGCATTCGAGGCCAAGCGGACCATCAATGCCATCTGGTTCCTCAACTTGGCGGTAGCCGACTTCCTCTCCTGCCTGGCGCTGCCCATCTTGTTCACGTCCATTGTACAGCATCACCACTGGCCCTTTGGCGGGGCCGCCTGCAGCATCCTGCCCTCCCTCATCCTGCTCAACATGTACGCCAGCATCCTGCTCCTGGCCACCATCAGCGCCGACCGCTTTCTGCTGGTGTTTAAACCCATCTGGTGCCAGAACTTCCGAGGGGCCGGCTTGGCCTGGATCGCCTGTGCCGTGGCTTGGGGTTTAGCCCTGCTGCTGACCATACCCTCCTTCCTGTACCGGGTGGTCCGGGAGGAGTACTTTCCACCAAAGGTGTTGTGTGGCGTGGACTACAGCCACGACAAACGGCGGGAGCGAGCCGTGGCCATCGTCCGGCTGGTCCTGGGCTTCCTGTGGCCTCTACTCACGCTCACGATTTGTTACACTTTCATCCTGCTCCGGACGTGGAGCCGCAGGGCCACGCGGTCCACCAAGACACTCAAGGTGGTGGTGGCAGTGGTGGCCAGTTTCTTTATCTTCTGGTTGCCCTACCAGGTGACGGGGATAATGATGTCCTTCCTGGAGCCATCGTCACCCACCTTCCTGCTGCTGAATAAGCTGGACTCCCTGTGTGTCTCCTTTGCCTACATCAACTGCTGCATCAACCCCATCATCTACGTGGTGGCCGGCCAGGGCTTCCAGGGCCGACTGCGGAAATCCCTCCCCAGCCTCCTCCGGAACGTGTTGACTGAAGAGTCCGTGGTTAGGGAGAGCAAGTCATTCACGCGCTCCACAGTGGACACTATGGCCCAGAAGACCCAGGCAGTGTAG |
| ORF Protein Sequence | MNSFNYTTPDYGHYDDKDTLDLNTPVDKTSNTLRVPDILALVIFAVVFLVGVLGNALVVWVTAFEAKRTINAIWFLNLAVADFLSCLALPILFTSIVQHHHWPFGGAACSILPSLILLNMYASILLLATISADRFLLVFKPIWCQNFRGAGLAWIACAVAWGLALLLTIPSFLYRVVREEYFPPKVLCGVDYSHDKRRERAVAIVRLVLGFLWPLLTLTICYTFILLRTWSRRATRSTKTLKVVVAVVASFFIFWLPYQVTGIMMSFLEPSSPTFLLLNKLDSLCVSFAYINCCINPIIYVVAGQGFQGRLRKSLPSLLRNVLTEESVVRESKSFTRSTVDTMAQKTQAV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-039 | Pre-Made Avdoralimab biosimilar, Whole mAb, Anti-C5AR1 Antibody: Anti-C5AR/C5R1/CD88 therapeutic antibody |
| Target Antibody | GM-Tg-g-T15439-Ab | Anti-C5AR1/ C5A/ C5AR monoclonal antibody |
| Target Antigen | GM-Tg-g-T15439-Ag | C5AR1 VLP (virus-like particle) |
| ORF Viral Vector | pGMAP000035 | Human C5AR1 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000067 | Human C5AR1 Adenovirus plasmid |
| ORF Viral Vector | vGMAP000035 | Human C5AR1 Adenovirus particle |
| ORF Viral Vector | vGMAP000067 | Human C5AR1 Adenovirus particle |
Target information
| Target ID | GM-T15439 |
| Target Name | C5aR/C5AR1/CD88 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
728 |
| Gene ID |
100065997 (Equus caballus), 101098593 (Felis catus), 113959 (Rattus norvegicus), 12273 (Mus musculus) 442974 (Canis lupus familiaris), 493645 (Bos taurus), 718056 (Macaca mulatta), 728 (Homo sapiens) |
| Gene Symbols & Synonyms | C5AR1,C5ar1,C5aR,C5r1,C5a-R,Cd88,D7Msu1,C5R1,C5AR,C5A,CD88 |
| Target Alternative Names | C5A,C5AR,C5AR1,C5R1,C5a anaphylatoxin chemotactic receptor (C5a-R,C5a anaphylatoxin chemotactic receptor 1,C5a-R,C5aR,C5aR),C5ar1,C5r1,CD88,Cd88,D7Msu1 |
| Uniprot Accession |
P21730,P30992,P30993,P79188,P97520
Additional SwissProt Accessions: P97520,P30993,P30992,P79188,P21730 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | |
| Disease from KEGG | Neuroactive ligand-receptor interaction, Complement and coagulation cascades, Alcoholic liver disease, Staphylococcus aureus infection |
| Gene Ensembl | ENSECAG00000006153, ENSMUSG00000049130, ENSCAFG00845002761, ENSMMUG00000009278, ENSG00000197405 |
| Target Classification | GPCR, Checkpoint-Immuno Oncology |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.