Human PDCD1/CD279/hPD-1 ORF/cDNA clone-Adenovirus particle (NM_005018)
Cat. No.: vGMAP-SPh-289
Pre-made Human PDCD1/CD279/hPD-1 Adenovirus for PDCD1 overexpression in-vitro and in-vivo. The PDCD1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PDCD1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
PD-1/CD279/PDCD1/PDCD1/CD279 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-289 | Human PDCD1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-289 |
| Gene Name | PDCD1 |
| Accession Number | NM_005018 |
| Gene ID | 5133 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 867 bp |
| Gene Alias | CD279,hPD-1,hPD-l,hSLE1,PD-1,PD1,SLEB2 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCTGGCGGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGCAGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGGCCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCAAGGCGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCCTCACCCAGGCCAGCCGGCCAGTTCCAAACCCTGGTGGTTGGTGTCGTGGGCGGCCTGCTGGGCAGCCTGGTGCTGCTAGTCTGGGTCCTGGCCGTCATCTGCTCCCGGGCCGCACGAGGGACAATAGGAGCCAGGCGCACCGGCCAGCCCCTGAAGGAGGACCCCTCAGCCGTGCCTGTGTTCTCTGTGGACTATGGGGAGCTGGATTTCCAGTGGCGAGAGAAGACCCCGGAGCCCCCCGTGCCCTGTGTCCCTGAGCAGACGGAGTATGCCACCATTGTCTTTCCTAGCGGAATGGGCACCTCATCCCCCGCCCGCAGGGGCTCAGCTGACGGCCCTCGGAGTGCCCAGCCACTGAGGCCTGAGGATGGACACTGCTCTTGGCCCCTCTGA |
| ORF Protein Sequence | MQIPQAPWPVVWAVLQLGWRPGWFLDSPDRPWNPPTFSPALLVVTEGDNATFTCSFSNTSESFVLNWYRMSPSNQTDKLAAFPEDRSQPGQDCRFRVTQLPNGRDFHMSVVRARRNDSGTYLCGAISLAPKAQIKESLRAELRVTERRAEVPTAHPSPSPRPAGQFQTLVVGVVGGLLGSLVLLVWVLAVICSRAARGTIGARRTGQPLKEDPSAVPVFSVDYGELDFQWREKTPEPPVPCVPEQTEYATIVFPSGMGTSSPARRGSADGPRSAQPLRPEDGHCSWPL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T59631 |
| Target Name | PD-1/CD279/PDCD1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
5133 |
| Gene ID |
100067948 (Equus caballus), 100135770 (Felis catus), 100135775 (Macaca mulatta), 18566 (Mus musculus) 301626 (Rattus norvegicus), 486213 (Canis lupus familiaris), 5133 (Homo sapiens), 613842 (Bos taurus) |
| Gene Symbols & Synonyms | PDCD1,Pdcd1,PD-1,PD1,Pdc1,Ly101,CD279,SLEB2,hPD-1,hPD-l,hSLE1,AIMTBS |
| Target Alternative Names | AIMTBS,CD279,Ly101,PD-1,PD1,PDCD1,Pdc1,Pdcd1,Programmed cell death protein 1,Protein PD-1,SLEB2,hPD-1,hPD-l,hSLE1 |
| Uniprot Accession |
Q02242,Q15116
Additional SwissProt Accessions: Q02242,Q15116 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | cancer |
| Disease from KEGG | Cell adhesion molecules, T cell receptor signaling pathway, PD-L1 expression and PD-1 checkpoint pathway in cancer |
| Gene Ensembl | ENSECAG00000023275, ENSMMUG00000063159, ENSMUSG00000026285, ENSCAFG00845024308, ENSG00000188389, ENSBTAG00000011543 |
| Target Classification | Checkpoint-Immuno Oncology, Cytokine Receptor, Pathway, Tumor-associated antigen (TAA) |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


