Human MFF/C2orf33/EMPF2 ORF/cDNA clone-Adenovirus particle (NM_020194)

Cat. No.: vGMAP-SPh-239

Pre-made Human MFF/C2orf33/EMPF2 Adenovirus for MFF overexpression in-vitro and in-vivo. The MFF adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MFF-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to MFF/C2orf33 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP-SPh-239 Human MFF Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP-SPh-239
Gene Name MFF
Accession Number NM_020194
Gene ID 56947
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1029 bp
Gene Alias C2orf33,EMPF2,GL004
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGTAAAGGAACAAGCAGTGACACATCACTAGGAAGGGTGAGCAGGGCAGCATTTCCTTCTCCCACTGCTGCTGAGATGGCAGAAATTAGTCGAATTCAGTACGAAATGGAATATACTGAAGGCATTAGTCAGCGAATGAGGGTCCCAGAAAAGTTAAAAGTAGCACCGCCAAACGCTGACCTGGAACAAGGATTCCAAGAAGGAGTTCCAAATGCTAGTGTGATAATGCAAGTTCCGGAGAGGATTGTTGTAGCAGGAAATAATGAAGATGTTTCATTTTCAAGACCAGCAGATCTTGACCTTATTCAGTCAACTCCCTTTAAACCCCTGGCACTGAAAACACCACCTCGTGTACTTACGCTGAGTGAAAGACCACTAGATTTTCTGGATTTAGAAAGACCTCCTACAACCCCTCAAAATGAAGAAATCCGAGCAGTTGGCAGACTAAAAAGAGAGCGGTCTATGAGTGAAAATGCTGTTCGCCAAAATGGACAGCTGGTCAGAAATGATTCTCTGTGGCACAGATCAGATTCTGCCCCAAGAAATAAAATTTCAAGGTTCCAGGCACCGATTTCTGCACCGGAGTACACTGTGACACCATCGCCACAACAGGCTCGGGTCTGTCCTCCCCATATGTTACCTGAAGATGGAGCTAATCTTTCCTCTGCTCGTGGCATTTTGTCGCTTATCCAGTCTTCTACTCGTAGGGCATACCAGCAGATCTTGGATGTGCTGGATGAAAATCGCAGACCTGTGTTGCGTGGTGGGTCTGCTGCCGCCACTTCTAATCCTCATCATGACAACGTCAGGTATGGCATTTCAAATATAGATACAACCATTGAAGGAACGTCAGATGACCTGACTGTTGTAGATGCAGCTTCACTAAGACGACAGATAATCAAACTAAATAGACGTCTACAACTTCTGGAAGAGGAGAACAAAGAACGTGCTAAAAGAGAAATGGTCATGTATTCAATTACTGTAGCTTTCTGGCTGCTTAATAGCTGGCTCTGGTTTCGCCGCTAG
ORF Protein Sequence MSKGTSSDTSLGRVSRAAFPSPTAAEMAEISRIQYEMEYTEGISQRMRVPEKLKVAPPNADLEQGFQEGVPNASVIMQVPERIVVAGNNEDVSFSRPADLDLIQSTPFKPLALKTPPRVLTLSERPLDFLDLERPPTTPQNEEIRAVGRLKRERSMSENAVRQNGQLVRNDSLWHRSDSAPRNKISRFQAPISAPEYTVTPSPQQARVCPPHMLPEDGANLSSARGILSLIQSSTRRAYQQILDVLDENRRPVLRGGSAAATSNPHHDNVRYGISNIDTTIEGTSDDLTVVDAASLRRQIIKLNRRLQLLEEENKERAKREMVMYSITVAFWLLNSWLWFRR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1171-Ab Anti-MFF monoclonal antibody
    Target Antigen GM-Tg-g-IP1171-Ag MFF protein
    ORF Viral Vector pGMLP003558 Human MFF Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-099 Human MFF Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-239 Human MFF Adenovirus plasmid
    ORF Viral Vector vGMLP003558 Human MFF Lentivirus particle
    ORF Viral Vector vGMLP-SPh-099 Human MFF Lentivirus particle
    ORF Viral Vector vGMAP-SPh-239 Human MFF Adenovirus particle


    Target information

    Target ID GM-IP1171
    Target Name MFF
    Gene Group Identifier
    (Target Gene ID in Homo species)
    56947
    Gene ID 100056853 (Equus caballus), 101087770 (Felis catus), 301563 (Rattus norvegicus), 477395 (Canis lupus familiaris)
    506291 (Bos taurus), 56947 (Homo sapiens), 708489 (Macaca mulatta), 75734 (Mus musculus)
    Gene Symbols & Synonyms MFF,Mff,RGD1310230,C2orf33,C2H2orf33,EMPF2,GL004,5230400G24Rik
    Target Alternative Names MFF,Mitochondrial fission factor,EMPF2,GL004,C2orf33
    Uniprot Accession Q3ZCD8,Q4KM98,Q6PCP5,Q9GZY8
    Additional SwissProt Accessions: Q4KM98,Q3ZCD8,Q9GZY8,Q6PCP5
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000004389, ENSCAFG00845015898, ENSBTAG00000021319, ENSG00000168958, ENSMMUG00000013246, ENSMUSG00000026150
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.