Human SHH/HHG1/HLP3 ORF/cDNA clone-Adenovirus particle (NM_000193.3)

Cat. No.: vGMAP-SPh-212

Pre-made Human SHH/HHG1/HLP3 Adenovirus for SHH overexpression in-vitro and in-vivo. The SHH adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SHH-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to SHH/HHG1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP-SPh-212 Human SHH Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP-SPh-212
Gene Name SHH
Accession Number NM_000193.3
Gene ID 6469
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1389 bp
Gene Alias HHG1,HLP3,HPE3,MCOPCB5,ShhNC,SMMCI,TPT,TPTPS
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCTGGTATGCTCGGGACTGGCGTGCGGACCGGGCAGGGGGTTCGGGAAGAGGAGGCACCCCAAAAAGCTGACCCCTTTAGCCTACAAGCAGTTTATCCCCAATGTGGCCGAGAAGACCCTAGGCGCCAGCGGAAGGTATGAAGGGAAGATCTCCAGAAACTCCGAGCGATTTAAGGAACTCACCCCCAATTACAACCCCGACATCATATTTAAGGATGAAGAAAACACCGGAGCGGACAGGCTGATGACTCAGAGGTGTAAGGACAAGTTGAACGCTTTGGCCATCTCGGTGATGAACCAGTGGCCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGGACGAAGATGGCCACCACTCAGAGGAGTCTCTGCACTACGAGGGCCGCGCAGTGGACATCACCACGTCTGACCGCGACCGCAGCAAGTACGGCATGCTGGCCCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCCAAGGCACATATCCACTGCTCGGTGAAAGCAGAGAACTCGGTGGCGGCCAAATCGGGAGGCTGCTTCCCGGGCTCGGCCACGGTGCACCTGGAGCAGGGCGGCACCAAGCTGGTGAAGGACCTGAGCCCCGGGGACCGCGTGCTGGCGGCGGACGACCAGGGCCGGCTGCTCTACAGCGACTTCCTCACTTTCCTGGACCGCGACGACGGCGCCAAGAAGGTCTTCTACGTGATCGAGACGCGGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTCTTTGTGGCGCCGCACAACGACTCGGCCACCGGGGAGCCCGAGGCGTCCTCGGGCTCGGGGCCGCCTTCCGGGGGCGCACTGGGGCCTCGGGCGCTGTTCGCCAGCCGCGTGCGCCCGGGCCAGCGCGTGTACGTGGTGGCCGAGCGTGACGGGGACCGCCGGCTCCTGCCCGCCGCTGTGCACAGCGTGACCCTAAGCGAGGAGGCCGCGGGCGCCTACGCGCCGCTCACGGCCCAGGGCACCATTCTCATCAACCGGGTGCTGGCCTCGTGCTACGCGGTCATCGAGGAGCACAGCTGGGCGCACCGGGCCTTCGCGCCCTTCCGCCTGGCGCACGCGCTCCTGGCTGCACTGGCGCCCGCGCGCACGGACCGCGGCGGGGACAGCGGCGGCGGGGACCGCGGGGGCGGCGGCGGCAGAGTAGCCCTAACCGCTCCAGGTGCTGCCGACGCTCCGGGTGCGGGGGCCACCGCGGGCATCCACTGGTACTCGCAGCTGCTCTACCAAATAGGCACCTGGCTCCTGGACAGCGAGGCCCTGCACCCGCTGGGCATGGCGGTCAAGTCCAGCTGA
ORF Protein Sequence MLLLARCLLLVLVSSLLVCSGLACGPGRGFGKRRHPKKLTPLAYKQFIPNVAEKTLGASGRYEGKISRNSERFKELTPNYNPDIIFKDEENTGADRLMTQRCKDKLNALAISVMNQWPGVKLRVTEGWDEDGHHSEESLHYEGRAVDITTSDRDRSKYGMLARLAVEAGFDWVYYESKAHIHCSVKAENSVAAKSGGCFPGSATVHLEQGGTKLVKDLSPGDRVLAADDQGRLLYSDFLTFLDRDDGAKKVFYVIETREPRERLLLTAAHLLFVAPHNDSATGEPEASSGSGPPSGGALGPRALFASRVRPGQRVYVVAERDGDRRLLPAAVHSVTLSEEAAGAYAPLTAQGTILINRVLASCYAVIEEHSWAHRAFAPFRLAHALLAALAPARTDRGGDSGGGDRGGGGGRVALTAPGAADAPGAGATAGIHWYSQLLYQIGTWLLDSEALHPLGMAVKSS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T12075-Ab Anti-SHH/ HHG1/ HLP3 monoclonal antibody
    Target Antigen GM-Tg-g-T12075-Ag SHH VLP (virus-like particle)
    ORF Viral Vector pGMAAV000001 Human SHH Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP-SPh-072 Human SHH Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-212 Human SHH Adenovirus plasmid
    ORF Viral Vector vGMAAV000001 Human SHH Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP-SPh-072 Human SHH Lentivirus particle
    ORF Viral Vector vGMAP-SPh-212 Human SHH Adenovirus particle


    Target information

    Target ID GM-T12075
    Target Name SHH
    Gene Group Identifier
    (Target Gene ID in Homo species)
    6469
    Gene ID 100147450 (Equus caballus), 111557492 (Felis catus), 20423 (Mus musculus), 286821 (Bos taurus)
    29499 (Rattus norvegicus), 608860 (Canis lupus familiaris), 6469 (Homo sapiens), 716553 (Macaca mulatta)
    Gene Symbols & Synonyms SHH,Shh,Hx,Dsh,Hhg1,Hxl3,HHG-1,ShhNC,M100081,9530036O11Rik,TPT,HHG1,HLP3,HPE3,SMMCI,TPTPS,MCOPCB5
    Target Alternative Names 9530036O11Rik,Dsh,HHG-1,HHG1,HLP3,HPE3,Hhg1,Hx,Hxl3,M100081,MCOPCB5,SHH,SMMCI,Shh,Shh unprocessed N-terminal signaling and C-terminal autoprocessing domains (ShhNC),ShhNC,Sonic hedgehog protein,TPT,TPTPS
    Uniprot Accession Q15465,Q62226,Q63673
    Additional SwissProt Accessions: Q62226,Q63673,Q15465
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Axon guidance, Pathways in cancer, Proteoglycans in cancer, Basal cell carcinoma, Gastric cancer
    Gene Ensembl ENSECAG00000023075, ENSMUSG00000002633, ENSBTAG00000024552, ENSCAFG00845013237, ENSG00000164690, ENSMMUG00000062128
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.