Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human MAPK3/ERK-1/ERK1 ORF/cDNA clone-Adenovirus particle (NM_002746)
Cat. No.: vGMAP-SPh-194
Pre-made Human MAPK3/ERK-1/ERK1 Adenovirus for MAPK3 overexpression in-vitro and in-vivo. The MAPK3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MAPK3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
MAPK3/ERK1/MAPK3/ERK-1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-194 | Human MAPK3 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-194 |
| Gene Name | MAPK3 |
| Accession Number | NM_002746 |
| Gene ID | 5595 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1140 bp |
| Gene Alias | ERK-1,ERK1,ERT2,HS44KDAP,HUMKER1A,p44-ERK1,p44-MAPK,P44ERK1,P44MAPK,PRKM3 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGGGGGTCGGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGACGTGGGCCCGCGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCGGCCTATGACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACCTACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAGAATGTCATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATCCTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTACCTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCAGACTCCAAAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACAGTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCCAGTGGCCGAGGAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGCGGCTGAAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCTGGAGGCCCCCTAG |
| ORF Protein Sequence | MAAAAAQGGGGGEPRRTEGVGPGVPGEVEMVKGQPFDVGPRYTQLQYIGEGAYGMVSSAYDHVRKTRVAIKKISPFEHQTYCQRTLREIQILLRFRHENVIGIRDILRASTLEAMRDVYIVQDLMETDLYKLLKSQQLSNDHICYFLYQILRGLKYIHSANVLHRDLKPSNLLINTTCDLKICDFGLARIADPEHDHTGFLTEYVATRWYRAPEIMLNSKGYTKSIDIWSVGCILAEMLSNRPIFPGKHYLDQLNHILGILGSPSQEDLNCIINMKARNYLQSLPSKTKVAWAKLFPKSDSKALDLLDRMLTFNPNKRITVEEALAHPYLEQYYDPTDEPVAEEPFTFAMELDDLPKERLKELIFQETARFQPGVLEAP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T23276-Ab | Anti-ERK1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T23276-Ag | ERK1/MAPK3 protein |
| ORF Viral Vector | pGMLP005482 | Human MAPK3 Lentivirus plasmid |
| ORF Viral Vector | pGMLP005593 | Human MAPK3 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-054 | Human MAPK3 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-194 | Human MAPK3 Adenovirus plasmid |
| ORF Viral Vector | vGMLP005482 | Human MAPK3 Lentivirus particle |
| ORF Viral Vector | vGMLP005593 | Human MAPK3 Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-054 | Human MAPK3 Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-194 | Human MAPK3 Adenovirus particle |
Target information
| Target ID | GM-T23276 |
| Target Name | MAPK3/ERK1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
5595 |
| Gene ID |
100066173 (Equus caballus), 100855877 (Canis lupus familiaris), 101087958 (Felis catus), 26417 (Mus musculus) 50689 (Rattus norvegicus), 531391 (Bos taurus), 5595 (Homo sapiens), 708938 (Macaca mulatta) |
| Gene Symbols & Synonyms | MAPK3,Mapk3,p44,Erk1,Ert2,Mnk1,Erk-1,Esrk1,Prkm3,Mtap2k,p44erk1,p44mapk,ERK1,ERT2,MNK1,MAPK1,ERK-1,PRKM3,P44ERK1,P44MAPK,HS44KDAP,HUMKER1A,p44-ERK1,p44-MAPK |
| Target Alternative Names | ERK-1,ERK1,ERT2,Erk-1,Erk1,Ert2,Esrk1,Extracellular signal-regulated kinase 1 (ERK-1),HS44KDAP,HUMKER1A,Insulin-stimulated MAP2 kinase,MAP kinase 3,MAP kinase isoform p44 (p44-MAPK),MAPK 3,MAPK1,MAPK3,MNK1,Mapk3,Microtubule-associated protein 2 kinase,Mitogen-activated protein kinase 3,Mnk1,Mtap2k,P44ERK1,P44MAPK,PRKM3,Prkm3,p44,p44-ERK1,p44-MAPK,p44erk1,p44mapk |
| Uniprot Accession |
P21708,P27361,Q63844
Additional SwissProt Accessions: Q63844,P21708,P27361 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | cancer, IgA glomerulonephritis |
| Disease from KEGG | EGFR tyrosine kinase inhibitor resistance, Endocrine resistance, MAPK signaling pathway, ErbB signaling pathway, Ras signaling pathway, Rap1 signaling pathway, cGMP-PKG signaling pathway, cAMP signaling pathway, Chemokine signaling pathway, HIF-1 signaling pathway, FoxO signaling pathway, Sphingolipid signaling pathway, Phospholipase D signaling pathway, PI3K-Akt signaling pathway, Apoptosis, Cellular senescence, Adrenergic signaling in cardiomyocytes, Vascular smooth muscle contraction, TGF-beta signaling pathway, Axon guidance, Osteoclast differentiation, Focal adhesion, Adherens junction, Gap junction, Signaling pathways regulating pluripotency of stem cells, Platelet activation, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, C-type lectin receptor signaling pathway, Natural killer cell mediated cytotoxicity, IL-17 signaling pathway, Th1 and Th2 cell differentiation, Th17 cell differentiation, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, TNF signaling pathway, Circadian entrainment, Long-term potentiation, Neurotrophin signaling pathway, Glutamatergic synapse, Cholinergic synapse, Serotonergic synapse, Regulation of actin cytoskeleton, GnRH signaling pathway, Melanogenesis, Prolactin signaling pathway, Thyroid hormone signaling pathway, Oxytocin signaling pathway, Relaxin signaling pathway, Parathyroid hormone synthesis, secretion and action, GnRH secretion, Type II diabetes mellitus, AGE-RAGE signaling pathway in diabetic complications, Cushing syndrome, Growth hormone synthesis, secretion and action, Aldosterone-regulated sodium reabsorption, Alzheimer disease, Pathogenic Escherichia coli infection, Pertussis, Yersinia infection, Leishmaniasis, Chagas disease, Toxoplasmosis, Tuberculosis, Hepatitis C, Hepatitis B, Human cytomegalovirus infection, Influenza A, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Pathways in cancer, Proteoglycans in cancer, Chemical carcinogenesis - receptor activation, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Thyroid cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer, Central carbon metabolism in cancer, Choline metabolism in cancer, PD-L1 expression and PD-1 checkpoint pathway in cancer, Lipid and atherosclerosis |
| Gene Ensembl | ENSECAG00000014460, ENSCAFG00845002016, ENSMUSG00000063065, ENSBTAG00000016156, ENSG00000102882, ENSMMUG00000017758 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.