Human TGFB3/ARVD/ARVD1 ORF/cDNA clone-Adenovirus particle (NM_003239)
Cat. No.: vGMAP-SPh-179
Pre-made Human TGFB3/ARVD/ARVD1 Adenovirus for TGFB3 overexpression in-vitro and in-vivo. The TGFB3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TGFB3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
TGF Beta 3/TGFB3/TGFB3/ARVD products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-179 | Human TGFB3 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-179 |
| Gene Name | TGFB3 |
| Accession Number | NM_003239 |
| Gene ID | 7043 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1239 bp |
| Gene Alias | ARVD,ARVD1,LDS5,RNHF,TGF-beta3 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTCAGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTGGAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACGGTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTGGAGGAGATGCATGGGGAGAGGGAGGAAGGCTGCACCCAGGAAAACACCGAGTCGGAATACTATGCCAAAGAAATCCATAAATTCGACATGATCCAGGGGCTGGCGGAGCACAACGAACTGGCTGTCTGCCCTAAAGGAATTACCTCCAAGGTTTTCCGCTTCAATGTGTCCTCAGTGGAGAAAAATAGAACCAACCTATTCCGAGCAGAATTCCGGGTCTTGCGGGTGCCCAACCCCAGCTCTAAGCGGAATGAGCAGAGGATCGAGCTCTTCCAGATCCTTCGGCCAGATGAGCACATTGCCAAACAGCGCTATATCGGTGGCAAGAATCTGCCCACACGGGGCACTGCCGAGTGGCTGTCCTTTGATGTCACTGACACTGTGCGTGAGTGGCTGTTGAGAAGAGAGTCCAACTTAGGTCTAGAAATCAGCATTCACTGTCCATGTCACACCTTTCAGCCCAATGGAGATATCCTGGAAAACATTCACGAGGTGATGGAAATCAAATTCAAAGGCGTGGACAATGAGGATGACCATGGCCGTGGAGATCTGGGGCGCCTCAAGAAGCAGAAGGATCACCACAACCCTCATCTAATCCTCATGATGATTCCCCCACACCGGCTCGACAACCCGGGCCAGGGGGGTCAGAGGAAGAAGCGGGCTTTGGACACCAATTACTGCTTCCGCAACTTGGAGGAGAACTGCTGTGTGCGCCCCCTCTACATTGACTTCCGACAGGATCTGGGCTGGAAGTGGGTCCATGAACCTAAGGGCTACTATGCCAACTTCTGCTCAGGCCCTTGCCCATACCTCCGCAGTGCAGACACAACCCACAGCACGGTGCTGGGACTGTACAACACTCTGAACCCTGAAGCATCTGCCTCGCCTTGCTGCGTGCCCCAGGACCTGGAGCCCCTGACCATCCTGTACTATGTTGGGAGGACCCCCAAAGTGGAGCAGCTCTCCAACATGGTGGTGAAGTCTTGTAAATGTAGCTGA |
| ORF Protein Sequence | MKMHLQRALVVLALLNFATVSLSLSTCTTLDFGHIKKKRVEAIRGQILSKLRLTSPPEPTVMTHVPYQVLALYNSTRELLEEMHGEREEGCTQENTESEYYAKEIHKFDMIQGLAEHNELAVCPKGITSKVFRFNVSSVEKNRTNLFRAEFRVLRVPNPSSKRNEQRIELFQILRPDEHIAKQRYIGGKNLPTRGTAEWLSFDVTDTVREWLLRRESNLGLEISIHCPCHTFQPNGDILENIHEVMEIKFKGVDNEDDHGRGDLGRLKKQKDHHNPHLILMMIPPHRLDNPGQGGQRKKRALDTNYCFRNLEENCCVRPLYIDFRQDLGWKWVHEPKGYYANFCSGPCPYLRSADTTHSTVLGLYNTLNPEASASPCCVPQDLEPLTILYYVGRTPKVEQLSNMVVKSCKCS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T22978-Ab | Anti-TGFB3/ ARVD/ ARVD1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T22978-Ag | TGFB3 VLP (virus-like particle) |
| Cytokine | cks-Tg-g-GM-T22978 | transforming growth factor, beta 3 (TGFB3) protein & antibody |
| ORF Viral Vector | pGMLP003661 | Human TGFB3 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-039 | Human TGFB3 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-179 | Human TGFB3 Adenovirus plasmid |
| ORF Viral Vector | vGMLP003661 | Human TGFB3 Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-039 | Human TGFB3 Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-179 | Human TGFB3 Adenovirus particle |
Target information
| Target ID | GM-T22978 |
| Target Name | TGF Beta 3/TGFB3 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
7043 |
| Gene ID |
100051765 (Equus caballus), 101098469 (Felis catus), 21809 (Mus musculus), 25717 (Rattus norvegicus) 490796 (Canis lupus familiaris), 538957 (Bos taurus), 703239 (Macaca mulatta), 7043 (Homo sapiens) |
| Gene Symbols & Synonyms | TGFB3,Tgfb3,Tgfb-3,TGF-beta-3,TGF-B3,TGFbeta3,ARVD,LDS5,RNHF,ARVD1,TGF-beta3 |
| Target Alternative Names | ARVD,ARVD1,LDS5,RNHF,TGF Beta 3,TGF-B3,TGF-beta-3,TGF-beta3,TGFB3,TGFbeta3,Tgfb-3,Tgfb3,Transforming growth factor beta-3 proprotein |
| Uniprot Accession |
P10600,P17125,Q07258
Additional SwissProt Accessions: P17125,Q07258,P10600 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
| Disease | cancer, Breast Cancer |
| Disease from KEGG | MAPK signaling pathway, Cytokine-cytokine receptor interaction, FoxO signaling pathway, Cellular senescence, TGF-beta signaling pathway, Hippo signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Leishmaniasis, Chagas disease, Malaria, Toxoplasmosis, Amoebiasis, Tuberculosis, Hepatitis B, Human T-cell leukemia virus 1 infection, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Chronic myeloid leukemia, Hepatocellular carcinoma, Gastric cancer, Inflammatory bowel disease, Rheumatoid arthritis, Hypertrophic cardiomyopathy, Dilated cardiomyopathy |
| Gene Ensembl | ENSECAG00000015029, ENSMUSG00000021253, ENSCAFG00845015760, ENSBTAG00000012004, ENSMMUG00000012069, ENSG00000119699 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


