Human TGFB2/G-TSF/LDS4 ORF/cDNA clone-Adenovirus particle (NM_003238)

Cat. No.: vGMAP-SPh-178

Pre-made Human TGFB2/G-TSF/LDS4 Adenovirus for TGFB2 overexpression in-vitro and in-vivo. The TGFB2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TGFB2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to TGF/TGFB2/TGFB2/G-TSF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP-SPh-178 Human TGFB2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP-SPh-178
Gene Name TGFB2
Accession Number NM_003238
Gene ID 7042
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1245 bp
Gene Alias G-TSF,LDS4,TGF-beta2
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCACTACTGTGTGCTGAGCGCTTTTCTGATCCTGCATCTGGTCACGGTCGCGCTCAGCCTGTCTACCTGCAGCACACTCGATATGGACCAGTTCATGCGCAAGAGGATCGAGGCGATCCGCGGGCAGATCCTGAGCAAGCTGAAGCTCACCAGTCCCCCAGAAGACTATCCTGAGCCCGAGGAAGTCCCCCCGGAGGTGATTTCCATCTACAACAGCACCAGGGACTTGCTCCAGGAGAAGGCGAGCCGGAGGGCGGCCGCCTGCGAGCGCGAGAGGAGCGACGAAGAGTACTACGCCAAGGAGGTTTACAAAATAGACATGCCGCCCTTCTTCCCCTCCGAAAATGCCATCCCGCCCACTTTCTACAGACCCTACTTCAGAATTGTTCGATTTGACGTCTCAGCAATGGAGAAGAATGCTTCCAATTTGGTGAAAGCAGAGTTCAGAGTCTTTCGTTTGCAGAACCCAAAAGCCAGAGTGCCTGAACAACGGATTGAGCTATATCAGATTCTCAAGTCCAAAGATTTAACATCTCCAACCCAGCGCTACATCGACAGCAAAGTTGTGAAAACAAGAGCAGAAGGCGAATGGCTCTCCTTCGATGTAACTGATGCTGTTCATGAATGGCTTCACCATAAAGACAGGAACCTGGGATTTAAAATAAGCTTACACTGTCCCTGCTGCACTTTTGTACCATCTAATAATTACATCATCCCAAATAAAAGTGAAGAACTAGAAGCAAGATTTGCAGGTATTGATGGCACCTCCACATATACCAGTGGTGATCAGAAAACTATAAAGTCCACTAGGAAAAAAAACAGTGGGAAGACCCCACATCTCCTGCTAATGTTATTGCCCTCCTACAGACTTGAGTCACAACAGACCAACCGGCGGAAGAAGCGTGCTTTGGATGCGGCCTATTGCTTTAGAAATGTGCAGGATAATTGCTGCCTACGTCCACTTTACATTGATTTCAAGAGGGATCTAGGGTGGAAATGGATACACGAACCCAAAGGGTACAATGCCAACTTCTGTGCTGGAGCATGCCCGTATTTATGGAGTTCAGACACTCAGCACAGCAGGGTCCTGAGCTTATATAATACCATAAATCCAGAAGCATCTGCTTCTCCTTGCTGCGTGTCCCAAGATTTAGAACCTCTAACCATTCTCTACTACATTGGCAAAACACCCAAGATTGAACAGCTTTCTAATATGATTGTAAAGTCTTGCAAATGCAGCTAA
ORF Protein Sequence MHYCVLSAFLILHLVTVALSLSTCSTLDMDQFMRKRIEAIRGQILSKLKLTSPPEDYPEPEEVPPEVISIYNSTRDLLQEKASRRAAACERERSDEEYYAKEVYKIDMPPFFPSENAIPPTFYRPYFRIVRFDVSAMEKNASNLVKAEFRVFRLQNPKARVPEQRIELYQILKSKDLTSPTQRYIDSKVVKTRAEGEWLSFDVTDAVHEWLHHKDRNLGFKISLHCPCCTFVPSNNYIIPNKSEELEARFAGIDGTSTYTSGDQKTIKSTRKKNSGKTPHLLLMLLPSYRLESQQTNRRKKRALDAAYCFRNVQDNCCLRPLYIDFKRDLGWKWIHEPKGYNANFCAGACPYLWSSDTQHSRVLSLYNTINPEASASPCCVSQDLEPLTILYYIGKTPKIEQLSNMIVKSCKCS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-889 Pre-Made Lerdelimumab Biosimilar, Whole Mab, Anti-Tgfb2 Antibody: Anti-G-TSF/LDS4/TGF-beta2 therapeutic antibody
    Target Antibody GM-Tg-g-T14143-Ab Anti-TGFB2/ G-TSF/ LDS4 functional antibody
    Target Antigen GM-Tg-g-T14143-Ag TGFB2 protein
    Cytokine cks-Tg-g-GM-T14143 transforming growth factor, beta 2 (TGFB2) protein & antibody
    ORF Viral Vector pGMLV000388 Human TGFB2 Lentivirus plasmid
    ORF Viral Vector pGMAP000588 Human TGFB2 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-038 Human TGFB2 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-178 Human TGFB2 Adenovirus plasmid
    ORF Viral Vector vGMLV000388 Human TGFB2 Lentivirus particle
    ORF Viral Vector vGMAP000588 Human TGFB2 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-038 Human TGFB2 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-178 Human TGFB2 Adenovirus particle


    Target information

    Target ID GM-T14143
    Target Name TGF/TGFB2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    7042
    Gene ID 100050377 (Equus caballus), 101093414 (Felis catus), 21808 (Mus musculus), 488596 (Canis lupus familiaris)
    534069 (Bos taurus), 7042 (Homo sapiens), 707540 (Macaca mulatta), 81809 (Rattus norvegicus)
    Gene Symbols & Synonyms TGFB2,Tgfb2,Tgfb-2,Tgf-beta2,TGFbeta2,MGF,LDS4,G-TSF,TGF-beta2,TGF-B2
    Target Alternative Names Cetermin,G-TSF,Glioblastoma-derived T-cell suppressor factor (G-TSF),LDS4,MGF,TGF,TGF-B2,TGF-beta2,TGFB2,TGFbeta2,Tgf-beta2,Tgfb-2,Tgfb2,Transforming growth factor beta-2 proprotein
    Uniprot Accession P21214,P27090,P61812,Q07257
    Additional SwissProt Accessions: P27090,P21214,P61812,Q07257
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease cancer
    Disease from KEGG MAPK signaling pathway, Cytokine-cytokine receptor interaction, FoxO signaling pathway, Cellular senescence, TGF-beta signaling pathway, Osteoclast differentiation, Hippo signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Leishmaniasis, Chagas disease, Malaria, Toxoplasmosis, Amoebiasis, Tuberculosis, Hepatitis B, Human T-cell leukemia virus 1 infection, Pathways in cancer, Proteoglycans in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Chronic myeloid leukemia, Hepatocellular carcinoma, Gastric cancer, Inflammatory bowel disease, Rheumatoid arthritis, Hypertrophic cardiomyopathy, Dilated cardiomyopathy
    Gene Ensembl ENSECAG00000041678,ENSECAG00000051604, ENSMUSG00000039239, ENSCAFG00845028176, ENSBTAG00000005359, ENSG00000092969, ENSMMUG00000004071
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.