Human TGFB1/CED/DPD1 ORF/cDNA clone-Adenovirus particle (NM_000660.6)

Cat. No.: vGMAP-SPh-177

Pre-made Human TGFB1/CED/DPD1 Adenovirus for TGFB1 overexpression in-vitro and in-vivo. The TGFB1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TGFB1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to TGF Beta 1/TGFB1/TGFB1/CED products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP-SPh-177 Human TGFB1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP-SPh-177
Gene Name TGFB1
Accession Number NM_000660.6
Gene ID 7040
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1173 bp
Gene Alias CED,DPD1,LAP,TGFB,TGFbeta
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCTGTGGCTACTGGTGCTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCCAGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTGTACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACTACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTCATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTGGACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATTGACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAACTTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTGGCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCGCTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCCAACATGATCGTGCGCTCCTGCAAGTGCAGCTGA
ORF Protein Sequence MPPSGLRLLPLLLPLLWLLVLTPGRPAAGLSTCKTIDMELVKRKRIEAIRGQILSKLRLASPPSQGEVPPGPLPEAVLALYNSTRDRVAGESAEPEPEPEADYYAKEVTRVLMVETHNEIYDKFKQSTHSIYMFFNTSELREAVPEPVLLSRAELRLLRLKLKVEQHVELYQKYSNNSWRYLSNRLLAPSDSPEWLSFDVTGVVRQWLSRGGEIEGFRLSAHCSCDSRDNTLQVDINGFTTGRRGDLATIHGMNRPFLLLMATPLERAQHLQSSRHRRALDTNYCFSSTEKNCCVRQLYIDFRKDLGWKWIHEPKGYHANFCLGPCPYIWSLDTQYSKVLALYNQHNPGASAAPCCVPQALEPLPIVYYVGRKPKVEQLSNMIVRSCKCS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-223 Pre-Made Fresolimumab biosimilar, Whole mAb, Anti-TGFB/TGFB1 Antibody: Anti-CED/DPD1/IBDIMDE/LAP therapeutic antibody
    Biosimilar GMP-Bios-INN-793 Pre-Made Dalutrafusp Alfa P Alfaiosimilar, Bispecific, Anti-NT5E/CD73;TGFB1;TGFB3 Antibody: Anti-eN/NTE/eNT/CALJA;CED/DPD1/IBDIMDE/LAP/TGF-beta1/TGFbeta;ARVD/ARVD1/LDS5/RNHF therapeutic antibody
    Biosimilar GMP-Bios-INN-908 Pre-Made Metelimumab Biosimilar, Whole Mab, Anti-Tgfb1 Antibody: Anti-CED/DPD1/IBDIMDE/LAP therapeutic antibody
    Target Antibody GM-Tg-g-T97257-Ab Anti-TGFB1/ CED/ DPD1 monoclonal antibody
    Target Antigen GM-Tg-g-T97257-Ag TGFB1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T97257 transforming growth factor, beta 1 (TGFB1) protein & antibody
    ORF Viral Vector pGMLP001905 Human TGFB1 Lentivirus plasmid
    ORF Viral Vector pGMAD000018 Human TGFB1 Adenovirus plasmid
    ORF Viral Vector pGMAD000417 Human TGFB1 Adenovirus plasmid
    ORF Viral Vector pGMAP000212 Human CED Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-037 Human TGFB1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-177 Human TGFB1 Adenovirus plasmid
    ORF Viral Vector pGMPC000678 Human TGFB1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001029 Human TGFB1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001905 Human TGFB1 Lentivirus particle
    ORF Viral Vector vGMAD000018 Human TGFB1 Adenovirus particle
    ORF Viral Vector vGMAD000417 Human TGFB1 Adenovirus particle
    ORF Viral Vector vGMAP000212 Human CED Adenovirus particle
    ORF Viral Vector vGMLP-SPh-037 Human TGFB1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-177 Human TGFB1 Adenovirus particle


    Target information

    Target ID GM-T97257
    Target Name TGF Beta 1/TGFB1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    7040
    Gene ID 100033900 (Equus caballus), 106992315 (Macaca mulatta), 21803 (Mus musculus), 282089 (Bos taurus)
    403998 (Canis lupus familiaris), 59086 (Rattus norvegicus), 7040 (Homo sapiens), 768263 (Felis catus)
    Gene Symbols & Synonyms TGFB1,Tgfb1,TGF-beta,Tgfb,Tgfb-1,TGFbeta1,TGF-beta1,CED,LAP,DPD1,TGFB,IBDIMDE,TGFbeta
    Target Alternative Names CED,DPD1,IBDIMDE,LAP,TGF Beta 1,TGF-beta,TGF-beta1,TGFB,TGFB1,TGFbeta,TGFbeta1,Tgfb,Tgfb-1,Tgfb1,Transforming growth factor beta-1 proprotein
    Uniprot Accession O19011,P01137,P04202,P17246,P18341,P54831
    Additional SwissProt Accessions: O19011,P04202,P18341,P54831,P17246,P01137
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease cancer, bladder cancer, Chronic Kidney Disease, Diabetic Nephropathy, Type 2 diabetes mellitus, Type 1 diabetes mellitus, Sickle Cell Nephropathy, Renal tubulo-interstitial diseases, Malignant neoplasm of bladder, Lupus Glomerulonephritis, Kidney disease
    Disease from KEGG MAPK signaling pathway, Cytokine-cytokine receptor interaction, FoxO signaling pathway, Cellular senescence, TGF-beta signaling pathway, Osteoclast differentiation, Hippo signaling pathway, Th17 cell differentiation, Intestinal immune network for IgA production, Relaxin signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Leishmaniasis, Chagas disease, Malaria, Toxoplasmosis, Amoebiasis, Tuberculosis, Hepatitis B, Human T-cell leukemia virus 1 infection, Pathways in cancer, Proteoglycans in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Chronic myeloid leukemia, Hepatocellular carcinoma, Gastric cancer, Inflammatory bowel disease, Rheumatoid arthritis, Hypertrophic cardiomyopathy, Dilated cardiomyopathy
    Gene Ensembl ENSECAG00000011671, ENSMMUG00000008142, ENSMUSG00000002603, ENSBTAG00000020457, ENSCAFG00845002395, ENSG00000105329
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.