Human MAPK8/JNK/JNK-46 ORF/cDNA clone-Adenovirus particle (NM_001323302.1)
Cat. No.: vGMAP-SPh-153
Pre-made Human MAPK8/JNK/JNK-46 Adenovirus for MAPK8 overexpression in-vitro and in-vivo. The MAPK8 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MAPK8-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
JNK/MAPK8/JNK1/MAPK8/JNK products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-153 | Human MAPK8 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-153 |
| Gene Name | MAPK8 |
| Accession Number | NM_001323302.1 |
| Gene ID | 5599 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1155 bp |
| Gene Alias | JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,PRKM8,SAPK1,SAPK1c |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGTGGATTTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAAATCCTCTTTCCAGGAAGGGACTATATTGATCAGTGGAATAAAGTTATTGAACAGCTTGGAACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAGGACTTACGTTGAAAACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTCCCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTGGTAATAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCCTTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGGGAACACACAATAGAAGAGTGGAAAGAATTGATATATAAGGAAGTTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGGGGCAGCCCTCTCCTTTAGCACAGGTGCAGCAGTGA |
| ORF Protein Sequence | MSRSKRDNNFYSVEIGDSTFTVLKRYQNLKPIGSGAQGIVCAAYDAILERNVAIKKLSRPFQNQTHAKRAYRELVLMKCVNHKNIIGLLNVFTPQKSLEEFQDVYIVMELMDANLCQVIQMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTAGTSFMMTPYVVTRYYRAPEVILGMGYKENVDLWSVGCIMGEMVCHKILFPGRDYIDQWNKVIEQLGTPCPEFMKKLQPTVRTYVENRPKYAGYSFEKLFPDVLFPADSEHNKLKASQARDLLSKMLVIDASKRISVDEALQHPYINVWYDPSEAEAPPPKIPDKQLDEREHTIEEWKELIYKEVMDLEERTKNGVIRGQPSPLAQVQQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T40097-Ab | Anti-JNK1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T40097-Ag | JNK1/MAPK8 protein |
| ORF Viral Vector | pGMLP005225 | Human MAPK8 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000121 | Human MAPK8 Adenovirus plasmid |
| ORF Viral Vector | pGMLP-SPh-013 | Human MAPK8 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-056 | Human MAPK8 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-153 | Human MAPK8 Adenovirus plasmid |
| ORF Viral Vector | pGMAP-SPh-196 | Human MAPK8 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000125 | Human MAPK8 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP005225 | Human MAPK8 Lentivirus particle |
| ORF Viral Vector | vGMAD000121 | Human MAPK8 Adenovirus particle |
| ORF Viral Vector | vGMLP-SPh-013 | Human MAPK8 Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-056 | Human MAPK8 Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-153 | Human MAPK8 Adenovirus particle |
| ORF Viral Vector | vGMAP-SPh-196 | Human MAPK8 Adenovirus particle |
Target information
| Target ID | GM-T40097 |
| Target Name | JNK/MAPK8/JNK1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
5599 |
| Gene ID |
100051798 (Equus caballus), 101091310 (Felis catus), 116554 (Rattus norvegicus), 26419 (Mus musculus) 477746 (Canis lupus familiaris), 539941 (Bos taurus), 5599 (Homo sapiens), 711115 (Macaca mulatta) |
| Gene Symbols & Synonyms | MAPK8,Mapk8,JNK,JNK1,Prkm8,SAPK1,PRKM8,JNK-46,JNK1A2,SAPK1c,JNK21B1/2 |
| Target Alternative Names | JNK,JNK-46,JNK1,JNK1A2,JNK21B1/2,MAP kinase 8,MAPK 8,MAPK8,Mapk8,Mitogen-activated protein kinase 8,PRKM8,Prkm8,SAPK1,SAPK1c,Stress-activated protein kinase 1c (SAPK1c),Stress-activated protein kinase JNK1,c-Jun N-terminal kinase 1 |
| Uniprot Accession |
P45983,P49185,Q91Y86
Additional SwissProt Accessions: P49185,Q91Y86,P45983 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | cancer |
| Disease from KEGG | Endocrine resistance, MAPK signaling pathway, ErbB signaling pathway, Ras signaling pathway, cAMP signaling pathway, FoxO signaling pathway, Sphingolipid signaling pathway, Protein processing in endoplasmic reticulum, Apoptosis, Apoptosis - multiple species, Wnt signaling pathway, Osteoclast differentiation, Focal adhesion, Tight junction, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, C-type lectin receptor signaling pathway, IL-17 signaling pathway, Th1 and Th2 cell differentiation, Th17 cell differentiation, T cell receptor signaling pathway, Fc epsilon RI signaling pathway, TNF signaling pathway, Neurotrophin signaling pathway, Inflammatory mediator regulation of TRP channels, GnRH signaling pathway, Prolactin signaling pathway, Adipocytokine signaling pathway, Relaxin signaling pathway, Type II diabetes mellitus, Insulin resistance, AGE-RAGE signaling pathway in diabetic complications, Growth hormone synthesis, secretion and action, Alcoholic liver disease, Alzheimer disease, Epithelial cell signaling in Helicobacter pylori infection, Pathogenic Escherichia coli infection, Pertussis, Yersinia infection, Chagas disease, Toxoplasmosis, Tuberculosis, Hepatitis B, Measles, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Colorectal cancer, Pancreatic cancer, Choline metabolism in cancer, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis |
| Gene Ensembl | ENSECAG00000008480, ENSMUSG00000021936, ENSCAFG00845019380, ENSBTAG00000007876, ENSG00000107643, ENSMMUG00000004060 |
| Target Classification | Kinase, Tumor-associated antigen (TAA) |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


