Human IL34/C16orf77/IL-34 ORF/cDNA clone-Adenovirus particle (NM_001172772)
Cat. No.: vGMAP-IL-121
Pre-made Human IL34/C16orf77/IL-34 Adenovirus for IL34 overexpression in-vitro and in-vivo. The IL34 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL34-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IL34/C16orf77 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-IL-121 | Human IL34 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-IL-121 |
| Gene Name | IL34 |
| Accession Number | NM_001172772 |
| Gene ID | 146433 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 729 bp |
| Gene Alias | C16orf77,IL-34 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGCCCCGGGGCTTCACCTGGCTGCGCTATCTTGGGATCTTCCTTGGCGTGGCCTTGGGGAATGAGCCTTTGGAGATGTGGCCCTTGACGCAGAATGAGGAGTGCACTGTCACGGGTTTTCTGCGGGACAAGCTGCAGTACAGGAGCCGACTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGTGTGCCTTACGAGGGGGTGTTCAGAATCGCCAACGTCACCAGGCTGCAGAGGGCCCAGGTGAGCGAGCGGGAGCTGCGGTATCTGTGGGTCTTGGTGAGCCTCAGTGCCACTGAGTCGGTGCAGGACGTGCTGCTCGAGGGCCACCCATCCTGGAAGTACCTGCAGGAGGTGGAGACGCTGCTGCTGAATGTCCAGCAGGGCCTCACGGATGTGGAGGTCAGCCCCAAGGTGGAATCCGTGTTGTCCCTCTTGAATGCCCCAGGGCCAAACCTGAAGCTGGTGCGGCCCAAAGCCCTGCTGGACAACTGCTTCCGGGTCATGGAGCTGCTGTACTGCTCCTGCTGTAAACAAAGCTCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGTCTTGCAGCCCAGAGCCCTCATTGCAGTATGCGGCCACCCAGCTGTACCCTCCGCCCCCGTGGTCCCCCAGCTCCCCGCCTCACTCCACGGGCTCGGTGAGGCCGGTCAGGGCACAGGGCGAGGGCCTCTTGCCCTGA |
| ORF Protein Sequence | MPRGFTWLRYLGIFLGVALGNEPLEMWPLTQNEECTVTGFLRDKLQYRSRLQYMKHYFPINYKISVPYEGVFRIANVTRLQRAQVSERELRYLWVLVSLSATESVQDVLLEGHPSWKYLQEVETLLLNVQQGLTDVEVSPKVESVLSLLNAPGPNLKLVRPKALLDNCFRVMELLYCSCCKQSSVLNWQDCEVPSPQSCSPEPSLQYAATQLYPPPPWSPSSPPHSTGSVRPVRAQGEGLLP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1028-Ab | Anti-IL34/ C16orf77/ IL-34 functional antibody |
| Target Antigen | GM-Tg-g-SE1028-Ag | IL34 protein |
| ORF Viral Vector | pGMLV000372 | Human IL34 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-IL-038 | Human IL34 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-IL-121 | Human IL34 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000680 | Human IL34 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV000372 | Human IL34 Lentivirus particle |
| ORF Viral Vector | vGMLP-IL-038 | Human IL34 Lentivirus particle |
| ORF Viral Vector | vGMAP-IL-121 | Human IL34 Adenovirus particle |
Target information
| Target ID | GM-SE1028 |
| Target Name | IL34 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
146433 |
| Gene ID |
100054703 (Equus caballus), 101094391 (Felis catus), 146433 (Homo sapiens), 498951 (Rattus norvegicus) 508292 (Bos taurus), 610536 (Canis lupus familiaris), 709034 (Macaca mulatta), 76527 (Mus musculus) |
| Gene Symbols & Synonyms | IL34,Il34,IL-34,C16orf77,C18H16ORF77,2010004A03Rik |
| Target Alternative Names | 2010004A03Rik,C16orf77,C18H16ORF77,IL-34,IL34,Il34,Interleukin-34 |
| Uniprot Accession |
A6QL48,Q4KM46,Q6ZMJ4,Q8R1R4
Additional SwissProt Accessions: Q6ZMJ4,Q4KM46,A6QL48,Q8R1R4 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | |
| Disease | |
| Disease from KEGG | Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor |
| Gene Ensembl | ENSECAG00000012327, ENSG00000157368, ENSBTAG00000009357, ENSCAFG00845005263, ENSMMUG00000020415, ENSMUSG00000031750 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


