Human IGFBP5/IBP5 ORF/cDNA clone-Adenovirus particle (NM_000599.4)

Cat. No.: vGMAD001653

Pre-made Human IGFBP5/IBP5 Adenovirus for IGFBP5 overexpression in-vitro and in-vivo. The IGFBP5 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IGFBP5-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to IGFBP5/IBP5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001653 Human IGFBP5 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001653
Gene Name IGFBP5
Accession Number NM_000599.4
Gene ID 3488
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 819 bp
Gene Alias IBP5
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGTGTTGCTCACCGCGGTCCTCCTGCTGCTGGCCGCCTATGCGGGGCCGGCCCAGAGCCTGGGCTCCTTCGTGCACTGCGAGCCCTGCGACGAGAAAGCCCTCTCCATGTGCCCCCCCAGCCCCCTGGGCTGCGAGCTGGTCAAGGAGCCGGGCTGCGGCTGCTGCATGACCTGCGCCCTGGCCGAGGGGCAGTCGTGCGGCGTCTACACCGAGCGCTGCGCCCAGGGGCTGCGCTGCCTCCCCCGGCAGGACGAGGAGAAGCCGCTGCACGCCCTGCTGCACGGCCGCGGGGTTTGCCTCAACGAAAAGAGCTACCGCGAGCAAGTCAAGATCGAGAGAGACTCCCGTGAGCACGAGGAGCCCACCACCTCTGAGATGGCCGAGGAGACCTACTCCCCCAAGATCTTCCGGCCCAAACACACCCGCATCTCCGAGCTGAAGGCTGAAGCAGTGAAGAAGGACCGCAGAAAGAAGCTGACCCAGTCCAAGTTTGTCGGGGGAGCCGAGAACACTGCCCACCCCCGGATCATCTCTGCACCTGAGATGAGACAGGAGTCTGAGCAGGGCCCCTGCCGCAGACACATGGAGGCTTCCCTGCAGGAGCTCAAAGCCAGCCCACGCATGGTGCCCCGTGCTGTGTACCTGCCCAATTGTGACCGCAAAGGATTCTACAAGAGAAAGCAGTGCAAACCTTCCCGTGGCCGCAAACGTGGCATCTGCTGGTGCGTGGACAAGTACGGGATGAAGCTGCCAGGCATGGAGTACGTTGACGGGGACTTTCAGTGCCACACCTTCGACAGCAGCAACGTTGAGTGA
ORF Protein Sequence MVLLTAVLLLLAAYAGPAQSLGSFVHCEPCDEKALSMCPPSPLGCELVKEPGCGCCMTCALAEGQSCGVYTERCAQGLRCLPRQDEEKPLHALLHGRGVCLNEKSYREQVKIERDSREHEEPTTSEMAEETYSPKIFRPKHTRISELKAEAVKKDRRKKLTQSKFVGGAENTAHPRIISAPEMRQESEQGPCRRHMEASLQELKASPRMVPRAVYLPNCDRKGFYKRKQCKPSRGRKRGICWCVDKYGMKLPGMEYVDGDFQCHTFDSSNVE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0987-Ab Anti-IBP5/ IGFBP5 functional antibody
    Target Antigen GM-Tg-g-SE0987-Ag IGFBP5 protein
    Cytokine cks-Tg-g-GM-SE0987 insulin-like growth factor binding protein 5 (IGFBP5) protein & antibody
    ORF Viral Vector pGMLP000569 Human IGFBP5 Lentivirus plasmid
    ORF Viral Vector pGMAD001653 Human IGFBP5 Adenovirus plasmid
    ORF Viral Vector vGMLP000569 Human IGFBP5 Lentivirus particle
    ORF Viral Vector vGMAD001653 Human IGFBP5 Adenovirus particle


    Target information

    Target ID GM-SE0987
    Target Name IGFBP5
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3488
    Gene ID 100034063 (Equus caballus), 101084305 (Felis catus), 16011 (Mus musculus), 25285 (Rattus norvegicus)
    3488 (Homo sapiens), 404185 (Bos taurus), 610316 (Canis lupus familiaris), 696339 (Macaca mulatta)
    Gene Symbols & Synonyms IGFBP5,Igfbp5,IGFBP-5,IGFBP-5P,IGF-BP5,IBP5
    Target Alternative Names IBP-5,IBP5,IGF-BP5,IGF-binding protein 5,IGFBP-5,IGFBP-5P,IGFBP5,Igfbp5,Insulin-like growth factor-binding protein 5
    Uniprot Accession P24593,P24594,Q05717,Q07079
    Additional SwissProt Accessions: Q07079,P24594,P24593,Q05717
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease cancer, Breast Cancer, Dent disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000013425, ENSMUSG00000026185, ENSG00000115461, ENSBTAG00000059978, ENSCAFG00845024936, ENSMMUG00000041480
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.