Human CCN2/CTGF/HCS24 ORF/cDNA clone-Adenovirus particle (NM_001901)
Cat. No.: vGMAD001305
Pre-made Human CCN2/CTGF/HCS24 Adenovirus for CCN2 overexpression in-vitro and in-vivo. The CCN2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CCN2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
CTGF/CCN2/CCN2/CTGF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAD001305 | Human CCN2 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAD001305 |
| Gene Name | CCN2 |
| Accession Number | NM_001901 |
| Gene ID | 1490 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1050 bp |
| Gene Alias | CTGF,HCS24,IGFBP8,NOV2 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGACCGCCGCCAGTATGGGCCCCGTCCGCGTCGCCTTCGTGGTCCTCCTCGCCCTCTGCAGCCGGCCGGCCGTCGGCCAGAACTGCAGCGGGCCGTGCCGGTGCCCGGACGAGCCGGCGCCGCGCTGCCCGGCGGGCGTGAGCCTCGTGCTGGACGGCTGCGGCTGCTGCCGCGTCTGCGCCAAGCAGCTGGGCGAGCTGTGCACCGAGCGCGACCCATGCGACCCGCACAAGGGCCTATTCTGTCACTTCGGCTCCCCGGCCAACCGCAAGATCGGCGTGTGCACCGCCAAAGATGGTGCTCCCTGCATCTTCGGTGGTACGGTGTACCGCAGCGGAGAGTCCTTCCAGAGCAGCTGCAAGTACCAGTGCACGTGCCTGGACGGGGCGGTGGGCTGCATGCCCCTGTGCAGCATGGACGTTCGTCTGCCCAGCCCTGACTGCCCCTTCCCGAGGAGGGTCAAGCTGCCCGGGAAATGCTGCGAGGAGTGGGTGTGTGACGAGCCCAAGGACCAAACCGTGGTTGGGCCTGCCCTCGCGGCTTACCGACTGGAAGACACGTTTGGCCCAGACCCAACTATGATTAGAGCCAACTGCCTGGTCCAGACCACAGAGTGGAGCGCCTGTTCCAAGACCTGTGGGATGGGCATCTCCACCCGGGTTACCAATGACAACGCCTCCTGCAGGCTAGAGAAGCAGAGCCGCCTGTGCATGGTCAGGCCTTGCGAAGCTGACCTGGAAGAGAACATTAAGAAGGGCAAAAAGTGCATCCGTACTCCCAAAATCTCCAAGCCTATCAAGTTTGAGCTTTCTGGCTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGA |
| ORF Protein Sequence | MTAASMGPVRVAFVVLLALCSRPAVGQNCSGPCRCPDEPAPRCPAGVSLVLDGCGCCRVCAKQLGELCTERDPCDPHKGLFCHFGSPANRKIGVCTAKDGAPCIFGGTVYRSGESFQSSCKYQCTCLDGAVGCMPLCSMDVRLPSPDCPFPRRVKLPGKCCEEWVCDEPKDQTVVGPALAAYRLEDTFGPDPTMIRANCLVQTTEWSACSKTCGMGISTRVTNDNASCRLEKQSRLCMVRPCEADLEENIKKGKKCIRTPKISKPIKFELSGCTSMKTYRAKFCGVCTDGRCCTPHRTTTLPVEFKCPDGEVMKKNMMFIKTCACHYNCPGDNDIFESLYYRKMYGDMA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T50444 |
| Target Name | CTGF/CCN2 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
1490 |
| Gene ID |
100073098 (Equus caballus), 101094598 (Felis catus), 14219 (Mus musculus), 1490 (Homo sapiens) 281103 (Bos taurus), 476202 (Canis lupus familiaris), 64032 (Rattus norvegicus), 714520 (Macaca mulatta) |
| Gene Symbols & Synonyms | CCN2,Ccn2,CTGF,Ctgf,Hcs24,Fisp12,fisp-12,NOV2,HCS24,IBP-8,IGFBP8,CTGRP |
| Target Alternative Names | CCN family member 2,CCN2,CTGF,CTGRP,Ccn2,Cellular communication network factor 2,Connective tissue growth factor,Ctgf,Fisp12,HCS24,Hcs24,Hypertrophic chondrocyte-specific protein 24,IBP-8,IGF-binding protein 8,IGFBP-8),IGFBP8,Insulin-like growth factor-binding protein 8 (IBP-8,NOV2,fisp-12 |
| Uniprot Accession |
O18739,P29268,P29279,Q9R1E9
Additional SwissProt Accessions: P29268,P29279,O18739,Q9R1E9 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, INN Index, Cytokine Target |
| Disease | cancer, Ovary Cancer, Chronic Kidney Disease, Type 1 diabetes mellitus with diabetic nephropathy, gastric cancer, Complications of kidney transplant |
| Disease from KEGG | Hippo signaling pathway |
| Gene Ensembl | ENSMUSG00000019997, ENSG00000118523, ENSBTAG00000006367, ENSCAFG00845004492, ENSMMUG00000014150 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


