Human CCN2/CTGF/HCS24 ORF/cDNA clone-Adenovirus particle (NM_001901)

Cat. No.: vGMAD001305

Pre-made Human CCN2/CTGF/HCS24 Adenovirus for CCN2 overexpression in-vitro and in-vivo. The CCN2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CCN2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to CTGF/CCN2/CCN2/CTGF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001305 Human CCN2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001305
Gene Name CCN2
Accession Number NM_001901
Gene ID 1490
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1050 bp
Gene Alias CTGF,HCS24,IGFBP8,NOV2
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGACCGCCGCCAGTATGGGCCCCGTCCGCGTCGCCTTCGTGGTCCTCCTCGCCCTCTGCAGCCGGCCGGCCGTCGGCCAGAACTGCAGCGGGCCGTGCCGGTGCCCGGACGAGCCGGCGCCGCGCTGCCCGGCGGGCGTGAGCCTCGTGCTGGACGGCTGCGGCTGCTGCCGCGTCTGCGCCAAGCAGCTGGGCGAGCTGTGCACCGAGCGCGACCCATGCGACCCGCACAAGGGCCTATTCTGTCACTTCGGCTCCCCGGCCAACCGCAAGATCGGCGTGTGCACCGCCAAAGATGGTGCTCCCTGCATCTTCGGTGGTACGGTGTACCGCAGCGGAGAGTCCTTCCAGAGCAGCTGCAAGTACCAGTGCACGTGCCTGGACGGGGCGGTGGGCTGCATGCCCCTGTGCAGCATGGACGTTCGTCTGCCCAGCCCTGACTGCCCCTTCCCGAGGAGGGTCAAGCTGCCCGGGAAATGCTGCGAGGAGTGGGTGTGTGACGAGCCCAAGGACCAAACCGTGGTTGGGCCTGCCCTCGCGGCTTACCGACTGGAAGACACGTTTGGCCCAGACCCAACTATGATTAGAGCCAACTGCCTGGTCCAGACCACAGAGTGGAGCGCCTGTTCCAAGACCTGTGGGATGGGCATCTCCACCCGGGTTACCAATGACAACGCCTCCTGCAGGCTAGAGAAGCAGAGCCGCCTGTGCATGGTCAGGCCTTGCGAAGCTGACCTGGAAGAGAACATTAAGAAGGGCAAAAAGTGCATCCGTACTCCCAAAATCTCCAAGCCTATCAAGTTTGAGCTTTCTGGCTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGA
ORF Protein Sequence MTAASMGPVRVAFVVLLALCSRPAVGQNCSGPCRCPDEPAPRCPAGVSLVLDGCGCCRVCAKQLGELCTERDPCDPHKGLFCHFGSPANRKIGVCTAKDGAPCIFGGTVYRSGESFQSSCKYQCTCLDGAVGCMPLCSMDVRLPSPDCPFPRRVKLPGKCCEEWVCDEPKDQTVVGPALAAYRLEDTFGPDPTMIRANCLVQTTEWSACSKTCGMGISTRVTNDNASCRLEKQSRLCMVRPCEADLEENIKKGKKCIRTPKISKPIKFELSGCTSMKTYRAKFCGVCTDGRCCTPHRTTTLPVEFKCPDGEVMKKNMMFIKTCACHYNCPGDNDIFESLYYRKMYGDMA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-424 Pre-Made Pamrevlumab biosimilar, Whole mAb, Anti-CTGF/CCN2 Antibody: Anti-HCS24/IGFBP8/NOV2 therapeutic antibody
    Target Antibody GM-Tg-g-T50444-Ab Anti-CCN2/ CTGF/ HCS24 monoclonal antibody
    Target Antigen GM-Tg-g-T50444-Ag CTGF/CCN2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T50444 connective tissue growth factor (CTGF) protein & antibody
    ORF Viral Vector pGMLV001357 Human CTGF Lentivirus plasmid
    ORF Viral Vector pGMLV002243 Human CCN2 Lentivirus plasmid
    ORF Viral Vector pGMLV002442 Human CCN2 Lentivirus plasmid
    ORF Viral Vector pGMAD000129 Human CTGF Adenovirus plasmid
    ORF Viral Vector pGMAD001305 Human CCN2 Adenovirus plasmid
    ORF Viral Vector pGMPC000028 Human CTGF Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV001357 Human CTGF Lentivirus particle
    ORF Viral Vector vGMLV002243 Human CCN2 Lentivirus particle
    ORF Viral Vector vGMLV002442 Human CCN2 Lentivirus particle
    ORF Viral Vector vGMAD000129 Human CTGF Adenovirus particle
    ORF Viral Vector vGMAD001305 Human CCN2 Adenovirus particle


    Target information

    Target ID GM-T50444
    Target Name CTGF/CCN2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    1490
    Gene ID 100073098 (Equus caballus), 101094598 (Felis catus), 14219 (Mus musculus), 1490 (Homo sapiens)
    281103 (Bos taurus), 476202 (Canis lupus familiaris), 64032 (Rattus norvegicus), 714520 (Macaca mulatta)
    Gene Symbols & Synonyms CCN2,Ccn2,CTGF,Ctgf,Hcs24,Fisp12,fisp-12,NOV2,HCS24,IBP-8,IGFBP8,CTGRP
    Target Alternative Names CTGF, CCN2,CCN family member 2,Cellular communication network factor 2, Connective tissue growth factor, Hypertrophic chondrocyte-specific protein 24, Insulin-like growth factor-binding protein 8 (IBP-8, IGF-binding protein 8, IGFBP-8),CTGF,NOV2,HCS24,IBP-8,IGFBP8
    Uniprot Accession O18739,P29268,P29279,Q9R1E9
    Additional SwissProt Accessions: P29268,P29279,O18739,Q9R1E9
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease cancer, Ovary Cancer, Chronic Kidney Disease, Type 1 diabetes mellitus with diabetic nephropathy, gastric cancer, Complications of kidney transplant
    Disease from KEGG Hippo signaling pathway
    Gene Ensembl ENSMUSG00000019997, ENSG00000118523, ENSBTAG00000006367, ENSCAFG00845004492, ENSMMUG00000014150
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.