Human ALKBH5/ABH5/OFOXD ORF/cDNA clone-Adenovirus particle (NM_017758.4)

Cat. No.: vGMAD001301

Pre-made Human ALKBH5/ABH5/OFOXD Adenovirus for ALKBH5 overexpression in-vitro and in-vivo. The ALKBH5 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified ALKBH5-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to ALKBH5/ABH5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001301 Human ALKBH5 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001301
Gene Name ALKBH5
Accession Number NM_017758.4
Gene ID 54890
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1185 bp
Gene Alias ABH5,OFOXD,OFOXD1
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCGGCCGCCAGCGGCTACACGGACCTGCGTGAGAAGCTCAAGTCCATGACGTCCCGGGACAACTATAAGGCGGGCAGCCGGGAGGCCGCCGCCGCTGCCGCAGCCGCCGTAGCCGCCGCAGCCGCAGCCGCCGCTGCCGCCGAACCTTACCCTGTGTCCGGGGCCAAGCGCAAGTATCAGGAGGACTCGGACCCCGAGCGCAGCGACTATGAGGAGCAGCAGCTGCAGAAGGAGGAGGAGGCGCGCAAGGTGAAGAGCGGCATCCGCCAGATGCGCCTCTTCAGCCAGGACGAGTGCGCCAAGATCGAGGCCCGCATTGACGAGGTGGTGTCCCGCGCTGAGAAGGGCCTGTACAACGAGCACACGGTGGACCGGGCCCCACTGCGCAACAAGTACTTCTTCGGCGAAGGCTACACTTACGGCGCCCAGCTGCAGAAGCGCGGGCCCGGCCAGGAGCGCCTCTACCCGCCGGGCGACGTGGACGAGATCCCCGAGTGGGTGCACCAGCTGGTGATCCAAAAGCTGGTGGAGCACCGCGTCATCCCCGAGGGCTTCGTCAACAGCGCCGTCATCAACGACTACCAGCCCGGCGGCTGCATCGTGTCTCACGTGGACCCCATCCACATCTTCGAGCGCCCCATCGTGTCCGTGTCCTTCTTTAGCGACTCTGCGCTGTGCTTCGGCTGCAAGTTCCAGTTCAAGCCTATTCGGGTGTCGGAACCAGTGCTTTCCCTGCCGGTGCGCAGGGGAAGCGTGACTGTGCTCAGTGGATATGCTGCTGATGAAATCACTCACTGCATACGGCCTCAGGACATCAAGGAGCGCCGAGCAGTCATCATCCTCAGGAAGACAAGATTAGATGCACCCCGGTTGGAAACAAAGTCCCTGAGCAGCTCCGTGTTACCACCCAGCTATGCTTCAGATCGCCTGTCAGGAAACAACAGGGACCCTGCTCTGAAACCCAAGCGGTCCCACCGCAAGGCAGACCCTGATGCTGCCCACAGGCCACGGATCCTGGAGATGGACAAGGAAGAGAACCGGCGCTCGGTGCTGCTGCCCACACACCGGCGGAGGGGTAGCTTCAGCTCTGAGAACTACTGGCGCAAGTCATACGAGTCCTCAGAGGACTGCTCTGAGGCAGCAGGCAGCCCTGCCCGAAAGGTGAAGATGCGGCGGCACTGA
ORF Protein Sequence MAAASGYTDLREKLKSMTSRDNYKAGSREAAAAAAAAVAAAAAAAAAAEPYPVSGAKRKYQEDSDPERSDYEEQQLQKEEEARKVKSGIRQMRLFSQDECAKIEARIDEVVSRAEKGLYNEHTVDRAPLRNKYFFGEGYTYGAQLQKRGPGQERLYPPGDVDEIPEWVHQLVIQKLVEHRVIPEGFVNSAVINDYQPGGCIVSHVDPIHIFERPIVSVSFFSDSALCFGCKFQFKPIRVSEPVLSLPVRRGSVTVLSGYAADEITHCIRPQDIKERRAVIILRKTRLDAPRLETKSLSSSVLPPSYASDRLSGNNRDPALKPKRSHRKADPDAAHRPRILEMDKEENRRSVLLPTHRRRGSFSSENYWRKSYESSEDCSEAAGSPARKVKMRRH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0327-Ab Anti-ALKBH5 monoclonal antibody
    Target Antigen GM-Tg-g-IP0327-Ag ALKBH5 protein
    ORF Viral Vector pGMLV000810 Human ALKBH5 Lentivirus plasmid
    ORF Viral Vector pGMLV001042 Human ALKBH5 Lentivirus plasmid
    ORF Viral Vector pGMLV001170 Human ALKBH5 Lentivirus plasmid
    ORF Viral Vector pGMAD001301 Human ALKBH5 Adenovirus plasmid
    ORF Viral Vector pGMPC000506 Human ALKBH5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000728 Human ALKBH5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000812 Human ALKBH5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000923 Human ALKBH5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000810 Human ALKBH5 Lentivirus particle
    ORF Viral Vector vGMLV001042 Human ALKBH5 Lentivirus particle
    ORF Viral Vector vGMLV001170 Human ALKBH5 Lentivirus particle
    ORF Viral Vector vGMAD001301 Human ALKBH5 Adenovirus particle


    Target information

    Target ID GM-IP0327
    Target Name ALKBH5
    Gene Group Identifier
    （Target Gene ID in Homo species)         		54890
    Gene ID 100050716 (Equus caballus), 101100260 (Felis catus), 268420 (Mus musculus), 303193 (Rattus norvegicus)
    533303 (Bos taurus), 54890 (Homo sapiens), 609383 (Canis lupus familiaris), 700205 (Macaca mulatta)
    Gene Symbols & Synonyms ALKBH5,Alkbh5,Abh5,Ofoxd,E130207K11,RGD1309496,ABH5,OFOXD,OFOXD1
    Target Alternative Names ABH5,ALKBH5,Abh5,Alkbh5,Alkylated DNA repair protein alkB homolog 5,Alpha-ketoglutarate-dependent dioxygenase alkB homolog 5,E130207K11,OFOXD,OFOXD1,Ofoxd,RGD1309496,RNA demethylase ALKBH5
    Uniprot Accession D3ZKD3,E1BH29,Q3TSG4,Q6P6C2
    Additional SwissProt Accessions: Q3TSG4,D3ZKD3,E1BH29,Q6P6C2
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000018358, ENSMUSG00000042650, ENSBTAG00000025046, ENSG00000091542, ENSCAFG00845021653, ENSMMUG00000018352
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.