Human WNT9A/WNT14 ORF/cDNA clone-Adenovirus particle (NM_003395.4)

Cat. No.: vGMAD001279

Pre-made Human WNT9A/WNT14 Adenovirus for WNT9A overexpression in-vitro and in-vivo. The WNT9A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified WNT9A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to WNT9A/WNT14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001279 Human WNT9A Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001279
Gene Name WNT9A
Accession Number NM_003395.4
Gene ID 7483
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1098 bp
Gene Alias WNT14
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGCTGGATGGGTCCCCGCTGGCGCGCTGGCTGGCCGCGGCCTTCGGGCTGACGCTGCTGCTCGCCGCGCTGCGCCCTTCGGCCGCCTACTTCGGGCTGACGGGCAGCGAGCCCCTGACCATCCTCCCGCTGACCCTGGAGCCAGAGGCGGCTGCCCAGGCGCACTACAAGGCCTGCGACCGGCTGAAGCTGGAGCGGAAGCAGCGGCGCATGTGCCGCCGGGACCCGGGCGTGGCAGAGACGCTGGTGGAGGCCGTGAGCATGAGTGCGCTCGAGTGCCAGTTCCAGTTCCGCTTTGAGCGCTGGAACTGCACGCTGGAGGGCCGCTACCGGGCCAGCCTGCTCAAGCGAGGCTTCAAGGAGACTGCCTTCCTCTATGCCATCTCCTCGGCTGGCCTGACGCACGCACTGGCCAAGGCGTGCAGCGCGGGCCGCATGGAGCGCTGTACCTGCGATGAGGCACCCGACCTGGAGAACCGTGAGGCCTGGCAGTGGGGGGGCTGCGGAGACAACCTTAAGTACAGCAGCAAGTTCGTCAAGGAATTCCTGGGCAGACGGTCAAGCAAGGATCTGCGAGCCCGTGTGGACTTCCACAACAACCTCGTGGGTGTGAAGGTGATCAAGGCTGGGGTGGAGACCACCTGCAAGTGCCACGGCGTGTCAGGCTCATGCACGGTGCGGACCTGCTGGCGGCAGTTGGCGCCTTTCCATGAGGTGGGCAAGCATCTGAAGCACAAGTATGAGACGGCACTCAAGGTGGGCAGCACCACCAATGAAGCTGCCGGCGAGGCAGGTGCCATCTCCCCACCACGGGGCCGTGCCTCGGGGGCAGGTGGCAGCGACCCGCTGCCCCGCACTCCAGAGCTGGTGCACCTGGATGACTCGCCTAGCTTCTGCCTGGCTGGCCGCTTCTCCCCGGGCACCGCTGGCCGTAGGTGCCACCGTGAGAAGAACTGCGAGAGCATCTGCTGTGGCCGCGGCCATAACACACAGAGCCGGGTGGTGACAAGGCCCTGCCAGTGCCAGGTGCGTTGGTGCTGCTATGTGGAGTGCAGGCAGTGCACGCAGCGTGAGGAGGTCTACACCTGCAAGGGCTGA
ORF Protein Sequence MLDGSPLARWLAAAFGLTLLLAALRPSAAYFGLTGSEPLTILPLTLEPEAAAQAHYKACDRLKLERKQRRMCRRDPGVAETLVEAVSMSALECQFQFRFERWNCTLEGRYRASLLKRGFKETAFLYAISSAGLTHALAKACSAGRMERCTCDEAPDLENREAWQWGGCGDNLKYSSKFVKEFLGRRSSKDLRARVDFHNNLVGVKVIKAGVETTCKCHGVSGSCTVRTCWRQLAPFHEVGKHLKHKYETALKVGSTTNEAAGEAGAISPPRGRASGAGGSDPLPRTPELVHLDDSPSFCLAGRFSPGTAGRRCHREKNCESICCGRGHNTQSRVVTRPCQCQVRWCCYVECRQCTQREEVYTCKG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0559-Ab Anti-WNT9A/ WNT14 functional antibody
    Target Antigen GM-Tg-g-SE0559-Ag WNT9A protein
    Cytokine cks-Tg-g-GM-SE0559 wingless-type MMTV integration site family, member 9A (WNT9A) protein & antibody
    ORF Viral Vector pGMLP005579 Human WNT9A Lentivirus plasmid
    ORF Viral Vector pGMAD001279 Human WNT9A Adenovirus plasmid
    ORF Viral Vector pGMPC001795 Human WNT9A Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005579 Human WNT9A Lentivirus particle
    ORF Viral Vector vGMAD001279 Human WNT9A Adenovirus particle


    Target information

    Target ID GM-SE0559
    Target Name WNT9A
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7483
    Gene ID 100061110 (Equus caballus), 111560436 (Felis catus), 216795 (Mus musculus), 287357 (Rattus norvegicus)
    482209 (Canis lupus familiaris), 511308 (Bos taurus), 696326 (Macaca mulatta), 7483 (Homo sapiens)
    Gene Symbols & Synonyms WNT9A,Wnt9a,Wnt14,wnt-14,WNT14
    Target Alternative Names Protein Wnt-14,Protein Wnt-9a,WNT14,WNT9A,Wnt14,Wnt9a,wnt-14
    Uniprot Accession O14904,Q8R5M2
    Additional SwissProt Accessions: Q8R5M2,O14904
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease
    Disease from KEGG Wnt signaling pathway, Hippo signaling pathway, Signaling pathways regulating pluripotency of stem cells, Melanogenesis, Cushing syndrome, Alzheimer disease, Human papillomavirus infection, Pathways in cancer, Proteoglycans in cancer, Basal cell carcinoma, Breast cancer, Hepatocellular carcinoma, Gastric cancer
    Gene Ensembl ENSECAG00000020178, ENSMUSG00000000126, ENSBTAG00000020267, ENSMMUG00000008338, ENSG00000143816
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.