Human LCN2/24p3/MSFI ORF/cDNA clone-Adenovirus particle (NM_005564.5)

Cat. No.: vGMAD001066

Pre-made Human LCN2/24p3/MSFI Adenovirus for LCN2 overexpression in-vitro and in-vivo. The LCN2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified LCN2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to NGAL/LCN2/LCN2/24p3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001066 Human LCN2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001066
Gene Name LCN2
Accession Number NM_005564.5
Gene ID 3934
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 597 bp
Gene Alias 24p3,MSFI,NGAL,p25
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
ORF Nucleotide Sequence ATGCCCCTAGGTCTCCTGTGGCTGGGCCTAGCCCTGTTGGGGGCTCTGCATGCCCAGGCCCAGGACTCCACCTCAGACCTGATCCCAGCCCCACCTCTGAGCAAGGTCCCTCTGCAGCAGAACTTCCAGGACAACCAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTCCCAATCGACCAGTGTATCGACGGCTGA
ORF Protein Sequence MPLGLLWLGLALLGALHAQAQDSTSDLIPAPPLSKVPLQQNFQDNQFQGKWYVVGLAGNAILREDKDPQKMYATIYELKEDKSYNVTSVLFRKKKCDYWIRTFVPGCQPGEFTLGNIKSYPGLTSYLVRVVSTNYNQHAMVFFKKVSQNREYFKITLYGRTKELTSELKENFIRFSKSLGLPENHIVFPVPIDQCIDG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T72010-Ab Anti-NGAL/ LCN2/ 24p3 functional antibody
    Target Antigen GM-Tg-g-T72010-Ag LCN2 protein
    ORF Viral Vector pGMLP002859 Human LCN2 Lentivirus plasmid
    ORF Viral Vector pGMLV001321 Human LCN2 Lentivirus plasmid
    ORF Viral Vector pGMAD001066 Human LCN2 Adenovirus plasmid
    ORF Viral Vector pGMPC000637 Human LCN2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000792 Human LCN2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001300 Human LCN2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001766 Human LCN2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002859 Human LCN2 Lentivirus particle
    ORF Viral Vector vGMLV001321 Human LCN2 Lentivirus particle
    ORF Viral Vector vGMAD001066 Human LCN2 Adenovirus particle


    Target information

    Target ID GM-T72010
    Target Name NGAL/LCN2
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3934
    Gene ID 100070310 (Equus caballus), 16819 (Mus musculus), 170496 (Rattus norvegicus), 3934 (Homo sapiens)
    491320 (Canis lupus familiaris), 526639 (Bos taurus), 697208 (Macaca mulatta)
    Gene Symbols & Synonyms LCN2,Lcn2,NRL,24p3,Sip24,p25,MSFI,NGAL
    Target Alternative Names 24p3,25 kDa alpha-2-microglobulin-related subunit of MMP-9,LCN2,Lcn2,Lipocalin-2,MSFI,NGAL,NRL,Neutrophil gelatinase-associated lipocalin,Oncogene 24p3,Siderocalin,Sip24,p25
    Uniprot Accession P11672,P30152,P80188
    Additional SwissProt Accessions: P11672,P30152,P80188
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker
    Disease cancer, Prostate Cancer, Complications of kidney transplant, Congenital hydronephrosis, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to hazardous aromatic compounds, Contrast - Induced Nephropathy, Delayed Graft Function, Dent disease, Diabetic Nephropathy, HIV-Associated Nephropathy, Hydronephrosis, Hypertension, Impaired renal function disease, Injury to Kidney, Intraoperative Renal Injury, Kidney transplant rejection, Lupus Glomerulonephritis, Neonatal urinary tract infection, Nephrectomy, Nephropathy induced by other drugs, medicaments and biological substances, Nephrotic syndrome, Nephrotic syndrome with diffuse membranous glomerulonephritis, Proteinuria, Renal fibrosis, Renovascular hypertension, Sepsis due to Enterococcus, Systemic inflammatory response syndrome (SIRS) of non-infectious origin with acute organ dysfunction, Systemic lupus erythematosus (SLE), Transplanted Heart Complication, Type 1 diabetes mellitus with diabetic nephropathy, Acute pancreatitis, Asphyxia neonatorum, Autosomal Dominant Polycystic Kidney Disease, Cardiogenic shock, Chronic Kidney Disease, Type 2 diabetes mellitus, Vasculitis, Vesicoureteral reflux
    Disease from KEGG IL-17 signaling pathway
    Gene Ensembl ENSECAG00000020957, ENSMUSG00000026822, ENSG00000148346, ENSCAFG00845029755, ENSBTAG00000014149, ENSMMUG00000023801
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.