Human GREM1/C15DUPq/CKTSF1B1 ORF/cDNA clone-Adenovirus particle (NM_013372.7)
Cat. No.: vGMAD000730
Pre-made Human GREM1/C15DUPq/CKTSF1B1 Adenovirus for GREM1 overexpression in-vitro and in-vivo. The GREM1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GREM1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
GREM1/Gremlin-1/GREM1/C15DUPq products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000730 | Human GREM1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000730 |
Gene Name | GREM1 |
Accession Number | NM_013372.7 |
Gene ID | 26585 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 555 bp |
Gene Alias | C15DUPq,CKTSF1B1,CRAC1,CRCS4,DAND2,DRM,DUP15q,GREMLIN,HMPS,HMPS1,IHG-2,MPSH,PIG2 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGAGCCGCACAGCCTACACGGTGGGAGCCCTGCTTCTCCTCTTGGGGACCCTGCTGCCGGCTGCTGAAGGGAAAAAGAAAGGGTCCCAAGGTGCCATCCCCCCGCCAGACAAGGCCCAGCACAATGACTCAGAGCAGACTCAGTCGCCCCAGCAGCCTGGCTCCAGGAACCGGGGGCGGGGCCAAGGGCGGGGCACTGCCATGCCCGGGGAGGAGGTGCTGGAGTCCAGCCAAGAGGCCCTGCATGTGACGGAGCGCAAATACCTGAAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAA |
ORF Protein Sequence | MSRTAYTVGALLLLLGTLLPAAEGKKKGSQGAIPPPDKAQHNDSEQTQSPQQPGSRNRGRGQGRGTAMPGEEVLESSQEALHVTERKYLKRDWCKTQPLKQTIHEEGCNSRTIINRFCYGQCNSFYIPRHIRKEEGSFQSCSFCKPKKFTTMMVTLNCPELQPPTKKKRVTRVKQCRCISIDLD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-669 | Pre-Made Ginisortamab biosimilar, Whole mAb, Anti-GREM1/Gremlin-1 Antibody: Anti-C15DUPq/CKTSF1B1/CRAC1/CRCS4/DAND2/DRM/DUP15q/GREMLIN/HMPS/HMPS1/IHG-2/MPSH/PIG2 therapeutic antibody |
Target Antibody | GM-Tg-g-T22104-Ab | Anti-GREM1/ Gremlin-1/ C15DUPq functional antibody |
Target Antigen | GM-Tg-g-T22104-Ag | Gremlin-1/GREM1 protein |
ORF Viral Vector | pGMLP000730 | Human GREM1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000730 | Human GREM1 Adenovirus plasmid |
ORF Viral Vector | vGMLP000730 | Human GREM1 Lentivirus particle |
ORF Viral Vector | vGMAD000730 | Human GREM1 Adenovirus particle |
Target information
Target ID | GM-T22104 |
Target Name | GREM1/Gremlin-1 |
Gene Group Identifier (Target Gene ID in Homo species) |
26585 |
Gene ID |
100057765 (Equus caballus), 101096735 (Felis catus), 23892 (Mus musculus), 26585 (Homo sapiens) 487475 (Canis lupus familiaris), 50566 (Rattus norvegicus), 539079 (Bos taurus), 574176 (Macaca mulatta) |
Gene Symbols & Synonyms | GREM1,Grem1,ld,Drm,Grem,Cktsf1b1,DRM,HMPS,MPSH,PIG2,CRAC1,CRCS4,DAND2,HMPS1,IHG-2,DUP15q,C15DUPq,GREMLIN,CKTSF1B1,drm,gremlin-1 |
Target Alternative Names | BMP antagonist 1,C15DUPq,CKTSF1B1,CRAC1,CRCS4,Cell proliferation-inducing gene 2 protein,Cktsf1b1,Cysteine knot superfamily 1,DAN domain family member 2,DAND2,DRM,DUP15q,Down-regulated in Mos-transformed cells protein,Drm,GREM1,GREMLIN,Grem,Grem1,Gremlin-1,HMPS,HMPS1,IHG-2,Increased in high glucose protein 2 (IHG-2),MPSH,PIG2,drm,gremlin-1,ld |
Uniprot Accession |
O35793,O60565,O70326,Q8WNY1
Additional SwissProt Accessions: O70326,O60565,O35793,Q8WNY1 |
Uniprot Entry Name | |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index |
Disease | cancer |
Disease from KEGG | TGF-beta signaling pathway |
Gene Ensembl | ENSECAG00000044796, ENSMUSG00000074934, ENSG00000166923, ENSBTAG00000050495, ENSMMUG00000001810 |
Target Classification | Tumor-associated antigen (TAA) |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.