Human TGFB1/CED/DPD1 ORF/cDNA clone-Adenovirus particle (NM_000660)
Cat. No.: vGMAD000417
Pre-made Human TGFB1/CED/DPD1 Adenovirus for TGFB1 overexpression in-vitro and in-vivo. The TGFB1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TGFB1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
TGF Beta 1/TGFB1/TGFB1/CED products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAD000417 | Human TGFB1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAD000417 |
| Gene Name | TGFB1 |
| Accession Number | NM_000660 |
| Gene ID | 7040 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1173 bp |
| Gene Alias | CED,DPD1,LAP,TGFB,TGFbeta |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCTGTGGCTACTGGTGCTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCCAGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTGTACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACTACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTCATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTGGACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATTGACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAACTTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTGGCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCGCTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCCAACATGATCGTGCGCTCCTGCAAGTGCAGCTGA |
| ORF Protein Sequence | MPPSGLRLLPLLLPLLWLLVLTPGRPAAGLSTCKTIDMELVKRKRIEAIRGQILSKLRLASPPSQGEVPPGPLPEAVLALYNSTRDRVAGESAEPEPEPEADYYAKEVTRVLMVETHNEIYDKFKQSTHSIYMFFNTSELREAVPEPVLLSRAELRLLRLKLKVEQHVELYQKYSNNSWRYLSNRLLAPSDSPEWLSFDVTGVVRQWLSRGGEIEGFRLSAHCSCDSRDNTLQVDINGFTTGRRGDLATIHGMNRPFLLLMATPLERAQHLQSSRHRRALDTNYCFSSTEKNCCVRQLYIDFRKDLGWKWIHEPKGYHANFCLGPCPYIWSLDTQYSKVLALYNQHNPGASAAPCCVPQALEPLPIVYYVGRKPKVEQLSNMIVRSCKCS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T97257 |
| Target Name | TGF Beta 1/TGFB1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
7040 |
| Gene ID |
100033900 (Equus caballus), 106992315 (Macaca mulatta), 21803 (Mus musculus), 282089 (Bos taurus) 403998 (Canis lupus familiaris), 59086 (Rattus norvegicus), 7040 (Homo sapiens), 768263 (Felis catus) |
| Gene Symbols & Synonyms | TGFB1,Tgfb1,TGF-beta,Tgfb,Tgfb-1,TGFbeta1,TGF-beta1,CED,LAP,DPD1,TGFB,IBDIMDE,TGFbeta |
| Target Alternative Names | CED,DPD1,IBDIMDE,LAP,TGF Beta 1,TGF-beta,TGF-beta1,TGFB,TGFB1,TGFbeta,TGFbeta1,Tgfb,Tgfb-1,Tgfb1,Transforming growth factor beta-1 proprotein |
| Uniprot Accession |
O19011,P01137,P04202,P17246,P18341,P54831
Additional SwissProt Accessions: O19011,P04202,P18341,P54831,P17246,P01137 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
| Disease | cancer, bladder cancer, Chronic Kidney Disease, Diabetic Nephropathy, Type 2 diabetes mellitus, Type 1 diabetes mellitus, Sickle Cell Nephropathy, Renal tubulo-interstitial diseases, Malignant neoplasm of bladder, Lupus Glomerulonephritis, Kidney disease |
| Disease from KEGG | MAPK signaling pathway, Cytokine-cytokine receptor interaction, FoxO signaling pathway, Cellular senescence, TGF-beta signaling pathway, Osteoclast differentiation, Hippo signaling pathway, Th17 cell differentiation, Intestinal immune network for IgA production, Relaxin signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Leishmaniasis, Chagas disease, Malaria, Toxoplasmosis, Amoebiasis, Tuberculosis, Hepatitis B, Human T-cell leukemia virus 1 infection, Pathways in cancer, Proteoglycans in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Chronic myeloid leukemia, Hepatocellular carcinoma, Gastric cancer, Inflammatory bowel disease, Rheumatoid arthritis, Hypertrophic cardiomyopathy, Dilated cardiomyopathy |
| Gene Ensembl | ENSECAG00000011671, ENSMMUG00000008142, ENSMUSG00000002603, ENSBTAG00000020457, ENSCAFG00845002395, ENSG00000105329 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


