Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human TREM1/CD354/TREM-1 ORF/cDNA clone-Adenovirus particle (NM_018643.4)
Cat. No.: vGMAD000291
Pre-made Human TREM1/CD354/TREM-1 Adenovirus for TREM1 overexpression in-vitro and in-vivo. The TREM1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TREM1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
TREM-1/CD354/TREM1/TREM1/CD354 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAD000291 | Human TREM1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAD000291 |
| Gene Name | TREM1 |
| Accession Number | NM_018643.4 |
| Gene ID | 54210 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 705 bp |
| Gene Alias | CD354,TREM-1 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGGAAGACCAGGCTCTGGGGGCTGCTGTGGATGCTCTTTGTCTCAGAACTCCGAGCTGCAACTAAATTAACTGAGGAAAAGTATGAACTGAAAGAGGGGCAGACCCTGGATGTGAAATGTGACTACACGCTAGAGAAGTTTGCCAGCAGCCAGAAAGCTTGGCAGATAATAAGGGACGGAGAGATGCCCAAGACCCTGGCATGCACAGAGAGGCCTTCAAAGAATTCCCATCCAGTCCAAGTGGGGAGGATCATACTAGAAGACTACCATGATCATGGTTTACTGCGCGTCCGAATGGTCAACCTTCAAGTGGAAGATTCTGGACTGTATCAGTGTGTGATCTACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCAGGGACCCCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCCTTGTGCCCACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCCACTCCTGACTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGGTTCCGGTGTTCAACATTGTCATTCTCCTGGCTGGTGGATTCCTGAGTAAGAGCCTGGTCTTCTCTGTCCTGTTTGCTGTCACGCTGAGGTCATTTGTACCCTAG |
| ORF Protein Sequence | MRKTRLWGLLWMLFVSELRAATKLTEEKYELKEGQTLDVKCDYTLEKFASSQKAWQIIRDGEMPKTLACTERPSKNSHPVQVGRIILEDYHDHGLLRVRMVNLQVEDSGLYQCVIYQPPKEPHMLFDRIRLVVTKGFSGTPGSNENSTQNVYKIPPTTTKALCPLYTSPRTVTQAPPKSTADVSTPDSEINLTNVTDIIRVPVFNIVILLAGGFLSKSLVFSVLFAVTLRSFVP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T89780-Ab | Anti-TREM1/ CD354/ TREM-1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T89780-Ag | TREM1 VLP (virus-like particle) |
| ORF Viral Vector | pGMAD000291 | Human TREM1 Adenovirus plasmid |
| ORF Viral Vector | vGMAD000291 | Human TREM1 Adenovirus particle |
Target information
| Target ID | GM-T89780 |
| Target Name | TREM-1/CD354/TREM1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
54210 |
| Gene ID |
100054285 (Equus caballus), 101099551 (Felis catus), 301229 (Rattus norvegicus), 404547 (Bos taurus) 54210 (Homo sapiens), 58217 (Mus musculus), 608994 (Canis lupus familiaris), 693558 (Macaca mulatta) |
| Gene Symbols & Synonyms | TREM1,Trem1,TREM-1,CD354 |
| Target Alternative Names | TREM-1, CD354, TREM1,Triggering receptor expressed on myeloid cells 1,TREM-1,Triggering receptor expressed on monocytes 1,CD354,TREM-1 |
| Uniprot Accession |
Q6QUN5,Q9JKE2,Q9NP99
Additional SwissProt Accessions: Q6QUN5,Q9NP99,Q9JKE2 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | |
| Disease from KEGG | |
| Gene Ensembl | ENSECAG00000017436, ENSBTAG00000017593, ENSG00000124731, ENSMUSG00000042265, ENSCAFG00845015313, ENSMMUG00000003674 |
| Target Classification | Pathway |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.