Human E2F1/E2F-1/RBAP1 ORF/cDNA clone-Adenovirus particle (NM_005225.2)

Cat. No.: vGMAD000181

Pre-made Human E2F1/E2F-1/RBAP1 Adenovirus for E2F1 overexpression in-vitro and in-vivo. The E2F1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified E2F1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to E2F1/E2F-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000181 Human E2F1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000181
Gene Name E2F1
Accession Number NM_005225.2
Gene ID 1869
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1314 bp
Gene Alias E2F-1,RBAP1,RBBP3,RBP3
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCTTGGCCGGGGCCCCTGCGGGCGGCCCATGCGCGCCGGCGCTGGAGGCCCTGCTCGGGGCCGGCGCGCTGCGGCTGCTCGACTCCTCGCAGATCGTCATCATCTCCGCCGCGCAGGACGCCAGCGCCCCGCCGGCTCCCACCGGCCCCGCGGCGCCCGCCGCCGGCCCCTGCGACCCTGACCTGCTGCTCTTCGCCACACCGCAGGCGCCCCGGCCCACACCCAGTGCGCCGCGGCCCGCGCTCGGCCGCCCGCCGGTGAAGCGGAGGCTGGACCTGGAAACTGACCATCAGTACCTGGCCGAGAGCAGTGGGCCAGCTCGGGGCAGAGGCCGCCATCCAGGAAAAGGTGTGAAATCCCCGGGGGAGAAGTCACGCTATGAGACCTCACTGAATCTGACCACCAAGCGCTTCCTGGAGCTGCTGAGCCACTCGGCTGACGGTGTCGTCGACCTGAACTGGGCTGCCGAGGTGCTGAAGGTGCAGAAGCGGCGCATCTATGACATCACCAACGTCCTTGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCACAGTGGGCGTCGGCGGACGGCTTGAGGGGTTGACCCAGGACCTCCGACAGCTGCAGGAGAGCGAGCAGCAGCTGGACCACCTGATGAATATCTGTACTACGCAGCTGCGCCTGCTCTCCGAGGACACTGACAGCCAGCGCCTGGCCTACGTGACGTGTCAGGACCTTCGTAGCATTGCAGACCCTGCAGAGCAGATGGTTATGGTGATCAAAGCCCCTCCTGAGACCCAGCTCCAAGCCGTGGACTCTTCGGAGAACTTTCAGATCTCCCTTAAGAGCAAACAAGGCCCGATCGATGTTTTCCTGTGCCCTGAGGAGACCGTAGGTGGGATCAGCCCTGGGAAGACCCCATCCCAGGAGGTCACTTCTGAGGAGGAGAACAGGGCCACTGACTCTGCCACCATAGTGTCACCACCACCATCATCTCCCCCCTCATCCCTCACCACAGATCCCAGCCAGTCTCTACTCAGCCTGGAGCAAGAACCGCTGTTGTCCCGGATGGGCAGCCTGCGGGCTCCCGTGGACGAGGACCGCCTGTCCCCGCTGGTGGCGGCCGACTCGCTCCTGGAGCATGTGCGGGAGGACTTCTCCGGCCTCCTCCCTGAGGAGTTCATCAGCCTTTCCCCACCCCACGAGGCCCTCGACTACCACTTCGGCCTCGAGGAGGGCGAGGGCATCAGAGACCTCTTCGACTGTGACTTTGGGGACCTCACCCCCCTGGATTTCTGA
ORF Protein Sequence MALAGAPAGGPCAPALEALLGAGALRLLDSSQIVIISAAQDASAPPAPTGPAAPAAGPCDPDLLLFATPQAPRPTPSAPRPALGRPPVKRRLDLETDHQYLAESSGPARGRGRHPGKGVKSPGEKSRYETSLNLTTKRFLELLSHSADGVVDLNWAAEVLKVQKRRIYDITNVLEGIQLIAKKSKNHIQWLGSHTTVGVGGRLEGLTQDLRQLQESEQQLDHLMNICTTQLRLLSEDTDSQRLAYVTCQDLRSIADPAEQMVMVIKAPPETQLQAVDSSENFQISLKSKQGPIDVFLCPEETVGGISPGKTPSQEVTSEEENRATDSATIVSPPPSSPPSSLTTDPSQSLLSLEQEPLLSRMGSLRAPVDEDRLSPLVAADSLLEHVREDFSGLLPEEFISLSPPHEALDYHFGLEEGEGIRDLFDCDFGDLTPLDF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T57059-Ab Anti-E2F1 monoclonal antibody
    Target Antigen GM-Tg-g-T57059-Ag E2F1 protein
    ORF Viral Vector pGMLP005626 Human E2F1 Lentivirus plasmid
    ORF Viral Vector pGMLV000914 Human E2F1 Lentivirus plasmid
    ORF Viral Vector pGMAD000181 Human E2F1 Adenovirus plasmid
    ORF Viral Vector pGMPC000581 Human E2F1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001342 Human E2F1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005626 Human E2F1 Lentivirus particle
    ORF Viral Vector vGMLV000914 Human E2F1 Lentivirus particle
    ORF Viral Vector vGMAD000181 Human E2F1 Adenovirus particle


    Target information

    Target ID GM-T57059
    Target Name E2F1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1869
    Gene ID 100069192 (Equus caballus), 101098454 (Felis catus), 13555 (Mus musculus), 1869 (Homo sapiens)
    399489 (Rattus norvegicus), 485839 (Canis lupus familiaris), 535369 (Bos taurus), 714126 (Macaca mulatta)
    Gene Symbols & Synonyms E2F1,E2f1,E2F-1,mKIAA4009,Tg(Wnt1-cre)2Sor,RBP3,RBAP1,RBBP3
    Target Alternative Names E2F-1,E2F1,E2f1,PBR3,RBAP1,RBBP3,RBP3,Retinoblastoma-associated protein 1 (RBAP-1),Retinoblastoma-binding protein 3 (RBBP-3),Tg(Wnt1-cre)2Sor,Transcription factor E2F1,mKIAA4009,pRB-binding protein E2F-1
    Uniprot Accession O09139,Q01094,Q61501
    Additional SwissProt Accessions: Q61501,Q01094,O09139
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Endocrine resistance, Cellular senescence, Cushing syndrome, Hepatitis C, Hepatitis B, Human cytomegalovirus infection, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Chemical carcinogenesis - receptor activation, Pancreatic cancer, Glioma, Prostate cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer
    Gene Ensembl ENSECAG00000012086, ENSMUSG00000027490, ENSG00000101412, ENSCAFG00845025182, ENSBTAG00000003971, ENSMMUG00000023550
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.