Human EVA1A/FAM176A/TMEM166 ORF/cDNA clone-Adenovirus particle (NM_001135032.1)

Cat. No.: vGMAD000066

Pre-made Human EVA1A/FAM176A/TMEM166 Adenovirus for EVA1A overexpression in-vitro and in-vivo. The EVA1A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified EVA1A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to EVA1A/FAM176A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000066 Human EVA1A Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000066
Gene Name EVA1A
Accession Number NM_001135032.1
Gene ID 84141
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 459 bp
Gene Alias FAM176A,TMEM166
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGCTGCCCCTCAGCCACAGCCCAGAGCACGTGGAGATGGCTTTGCTCAGCAACATCCTAGCGGCCTATTCCTTTGTCTCAGAAAATCCTGAGCGAGCAGCTCTGTACTTTGTTTCTGGCGTGTGCATCGGGCTGGTGCTGACCCTGGCTGCTCTGGTGATAAGGATCTCTTGCCACACAGACTGCAGGCGGCGTCCCGGGAAGAAGTTCCTGCAGGACAGAGAGAGCAGCAGCGACAGCAGCGACAGCGAGGATGGCAGTGAGGACACCGTGTCCGATCTCTCCGTGCGGAGACACCGCCGCTTCGAGAGGACTTTGAACAAGAATGTGTTCACCTCTGCGGAGGAGCTGGAGCGCGCCCAGCGGCTGGAGGAGCGCGAGCGCATCATCAGGGAGATCTGGATGAATGGCCAGCCTGAGGTGCCCGGGACCAGGAGCCTGAATCGCTACTATTAG
ORF Protein Sequence MRLPLSHSPEHVEMALLSNILAAYSFVSENPERAALYFVSGVCIGLVLTLAALVIRISCHTDCRRRPGKKFLQDRESSSDSSDSEDGSEDTVSDLSVRRHRRFERTLNKNVFTSAEELERAQRLEERERIIREIWMNGQPEVPGTRSLNRYY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0428-Ab Anti-EVA1A/ FAM176A/ TMEM166 monoclonal antibody
    Target Antigen GM-Tg-g-MP0428-Ag EVA1A VLP (virus-like particle)
    ORF Viral Vector pGMLV000817 Human EVA1A Lentivirus plasmid
    ORF Viral Vector pGMAD000066 Human EVA1A Adenovirus plasmid
    ORF Viral Vector vGMLV000817 Human EVA1A Lentivirus particle
    ORF Viral Vector vGMAD000066 Human EVA1A Adenovirus particle


    Target information

    Target ID GM-MP0428
    Target Name EVA1A
    Gene Group Identifier
    （Target Gene ID in Homo species)         		84141
    Gene ID 100068811 (Equus caballus), 101080449 (Felis catus), 232146 (Mus musculus), 483095 (Canis lupus familiaris)
    500221 (Rattus norvegicus), 528994 (Bos taurus), 710843 (Macaca mulatta), 84141 (Homo sapiens)
    Gene Symbols & Synonyms EVA1A,Eva1a,FAM176A,Fam176a,Tmem166,TMEM166,RGD1559797
    Target Alternative Names EVA1A,Eva1a,FAM176A,Fam176a,Protein FAM176A,Protein eva-1 homolog A,RGD1559797,TMEM166,Tmem166,Transmembrane protein 166
    Uniprot Accession Q91WM6,Q9H8M9
    Additional SwissProt Accessions: Q91WM6,Q9H8M9
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000032625,ENSECAG00000032943,ENSECAG00000038519,ENSECAG00000038865, ENSMUSG00000035104, ENSCAFG00845016600, ENSMMUG00000048322, ENSG00000115363
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.