Human SPP1/BNSP/BSPI ORF/cDNA clone-Adenovirus particle (NM_001040058.1)
Cat. No.: vGMAD000037
Pre-made Human SPP1/BNSP/BSPI Adenovirus for SPP1 overexpression in-vitro and in-vivo. The SPP1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SPP1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
OPN/Osteopontin/SPP1/SPP1/BNSP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000037 | Human SPP1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000037 |
Gene Name | SPP1 |
Accession Number | NM_001040058.1 |
Gene ID | 6696 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 945 bp |
Gene Alias | BNSP,BSPI,ETA-1,OPN |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAACAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTGGCCACATGGCTAAACCCTGACCCATCTCAGAAGCAGAATCTCCTAGCCCCACAGAATGCTGTGTCCTCTGAAGAAACCAATGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGATATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGACTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGATGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCACTCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACTGAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGAGGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGTTGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAA |
ORF Protein Sequence | MRIAVICFCLLGITCAIPVKQADSGSSEEKQLYNKYPDAVATWLNPDPSQKQNLLAPQNAVSSEETNDFKQETLPSKSNESHDHMDDMDDEDDDDHVDSQDSIDSNDSDDVDDTDDSHQSDESHHSDESDELVTDFPTDLPATEVFTPVVPTVDTYDGRGDSVVYGLRSKSKKFRRPDIQYPDATDEDITSHMESEELNGAYKAIPVAQDLNAPSDWDSRGKDSYETSQLDDQSAETHSHKQSRLYKRKANDESNEHSDVIDSQELSKVSREFHSHEFHSHEDMLVVDPKSKEEDKHLKFRISHELDSASSEVN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T00032-Ab | Anti-OSTP/ SPP1/ BNSP functional antibody |
Target Antigen | GM-Tg-g-T00032-Ag | SPP1 protein |
ORF Viral Vector | pGMLV000419 | Human SPP1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001852 | Human SPP1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000016 | Human SPP1 Adenovirus plasmid |
ORF Viral Vector | pGMAD000037 | Human SPP1 Adenovirus plasmid |
ORF Viral Vector | pGMAD001612 | Human SPP1 Adenovirus plasmid |
ORF Viral Vector | pGMAP000451 | Human SPP1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000786 | Human SPP1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000419 | Human SPP1 Lentivirus particle |
ORF Viral Vector | vGMLV001852 | Human SPP1 Lentivirus particle |
ORF Viral Vector | vGMAD000016 | Human SPP1 Adenovirus particle |
ORF Viral Vector | vGMAD000037 | Human SPP1 Adenovirus particle |
ORF Viral Vector | vGMAD001612 | Human SPP1 Adenovirus particle |
ORF Viral Vector | vGMAP000451 | Human SPP1 Adenovirus particle |
Target information
Target ID | GM-T00032 |
Target Name | OPN/Osteopontin/SPP1 |
Gene Group Identifier (Target Gene ID in Homo species) |
6696 |
Gene ID |
100053029 (Equus caballus), 101094264 (Felis catus), 20750 (Mus musculus), 25353 (Rattus norvegicus) 281499 (Bos taurus), 478471 (Canis lupus familiaris), 6696 (Homo sapiens), 704930 (Macaca mulatta) |
Gene Symbols & Synonyms | SPP1,Spp1,OP,2AR,Bsp,Eta,Opn,Ric,BNSP,BSPI,Opnl,Apl-1,ETA-1,Spp-1,OSP,OPN,OST |
Target Alternative Names | 2AR,Apl-1,BNSP,BSPI,Bone sialoprotein 1,Bsp,ETA-1,Eta,Nephropontin,OP,OPN,OSP,OST,Opn,Opnl,Osteopontin,Ric,SPP1,Secreted phosphoprotein 1 (SPP-1),Spp-1,Spp1,Urinary stone protein,Uropontin |
Uniprot Accession |
P08721,P10451,P10923,P31096
Additional SwissProt Accessions: P10923,P08721,P31096,P10451 |
Uniprot Entry Name | |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | cancer, Ovarian cancer, Acute kidney failure, Asphyxia neonatorum, Calculus of kidney, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to uranium, Dent disease, Hepatic fibrosis, Malignant neoplasm of bladder, Pregnant state, Sepsis |
Disease from KEGG | PI3K-Akt signaling pathway, Focal adhesion, ECM-receptor interaction, Toll-like receptor signaling pathway, GnRH secretion, Human papillomavirus infection |
Gene Ensembl | ENSECAG00000017191, ENSMUSG00000029304, ENSBTAG00000005260, ENSCAFG00845016131, ENSG00000118785, ENSMMUG00000008793 |
Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.