Human SPP1/BNSP/BSPI ORF/cDNA clone-Adenovirus particle (NM_001040058.1)

Cat. No.: vGMAD000037

Pre-made Human SPP1/BNSP/BSPI Adenovirus for SPP1 overexpression in-vitro and in-vivo. The SPP1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified SPP1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to OPN/Osteopontin/SPP1/SPP1/BNSP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000037 Human SPP1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000037
Gene Name SPP1
Accession Number NM_001040058.1
Gene ID 6696
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 945 bp
Gene Alias BNSP,BSPI,ETA-1,OPN
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAACAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTGGCCACATGGCTAAACCCTGACCCATCTCAGAAGCAGAATCTCCTAGCCCCACAGAATGCTGTGTCCTCTGAAGAAACCAATGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGATATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGACTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGATGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCACTCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACTGAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGAGGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGTTGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAA
ORF Protein Sequence MRIAVICFCLLGITCAIPVKQADSGSSEEKQLYNKYPDAVATWLNPDPSQKQNLLAPQNAVSSEETNDFKQETLPSKSNESHDHMDDMDDEDDDDHVDSQDSIDSNDSDDVDDTDDSHQSDESHHSDESDELVTDFPTDLPATEVFTPVVPTVDTYDGRGDSVVYGLRSKSKKFRRPDIQYPDATDEDITSHMESEELNGAYKAIPVAQDLNAPSDWDSRGKDSYETSQLDDQSAETHSHKQSRLYKRKANDESNEHSDVIDSQELSKVSREFHSHEFHSHEDMLVVDPKSKEEDKHLKFRISHELDSASSEVN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00032-Ab Anti-OSTP/ SPP1/ BNSP functional antibody
    Target Antigen GM-Tg-g-T00032-Ag SPP1 protein
    ORF Viral Vector pGMLV000419 Human SPP1 Lentivirus plasmid
    ORF Viral Vector pGMLV001852 Human SPP1 Lentivirus plasmid
    ORF Viral Vector pGMAD000016 Human SPP1 Adenovirus plasmid
    ORF Viral Vector pGMAD000037 Human SPP1 Adenovirus plasmid
    ORF Viral Vector pGMAD001612 Human SPP1 Adenovirus plasmid
    ORF Viral Vector pGMAP000451 Human SPP1 Adenovirus plasmid
    ORF Viral Vector pGMPC000786 Human SPP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000419 Human SPP1 Lentivirus particle
    ORF Viral Vector vGMLV001852 Human SPP1 Lentivirus particle
    ORF Viral Vector vGMAD000016 Human SPP1 Adenovirus particle
    ORF Viral Vector vGMAD000037 Human SPP1 Adenovirus particle
    ORF Viral Vector vGMAD001612 Human SPP1 Adenovirus particle
    ORF Viral Vector vGMAP000451 Human SPP1 Adenovirus particle


    Target information

    Target ID GM-T00032
    Target Name OPN/Osteopontin/SPP1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    6696
    Gene ID 100053029 (Equus caballus), 101094264 (Felis catus), 20750 (Mus musculus), 25353 (Rattus norvegicus)
    281499 (Bos taurus), 478471 (Canis lupus familiaris), 6696 (Homo sapiens), 704930 (Macaca mulatta)
    Gene Symbols & Synonyms SPP1,Spp1,OP,2AR,Bsp,Eta,Opn,Ric,BNSP,BSPI,Opnl,Apl-1,ETA-1,Spp-1,OSP,OPN,OST
    Target Alternative Names 2AR,Apl-1,BNSP,BSPI,Bone sialoprotein 1,Bsp,ETA-1,Eta,Nephropontin,OP,OPN,OSP,OST,Opn,Opnl,Osteopontin,Ric,SPP1,Secreted phosphoprotein 1 (SPP-1),Spp-1,Spp1,Urinary stone protein,Uropontin
    Uniprot Accession P08721,P10451,P10923,P31096
    Additional SwissProt Accessions: P10923,P08721,P31096,P10451
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease cancer, Ovarian cancer, Acute kidney failure, Asphyxia neonatorum, Calculus of kidney, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to uranium, Dent disease, Hepatic fibrosis, Malignant neoplasm of bladder, Pregnant state, Sepsis
    Disease from KEGG PI3K-Akt signaling pathway, Focal adhesion, ECM-receptor interaction, Toll-like receptor signaling pathway, GnRH secretion, Human papillomavirus infection
    Gene Ensembl ENSECAG00000017191, ENSMUSG00000029304, ENSBTAG00000005260, ENSCAFG00845016131, ENSG00000118785, ENSMMUG00000008793
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.