Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human LGALS1/GAL1/GBP ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_002305.3)
Cat. No.: vGMAAV000234
Pre-made Human LGALS1/GAL1/GBP Adeno-associated virus particle for LGALS1 in-vivo study, mechanism of action (MOA) research and LGALS1-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go to
Galectin-1/LGALS1/LGALS1/GAL1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
MSDS
Product information
| Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
| vGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
| 5.0E+12VG/ml | ||||
| 1E+13VG/ml | ||||
| 5E+13VG/ml | ||||
| 1E+14VG/ml | ||||
| Research Grade | 1.0E+12VG/ml | |||
| 5.0E+12VG/ml | ||||
| 1E+13VG/ml | ||||
| 5E+13VG/ml | ||||
| 1E+14VG/ml | ||||
| GMP-like Grade | inquiry | |||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAAV000234 |
| Gene Name | LGALS1 |
| Accession Number | NM_002305.3 |
| Gene ID | 3956 |
| Species | Human |
| Product Type | Adeno-associate virus(AAV) particle (overexpression) |
| Insert Length | 408 bp |
| Gene Alias | GAL1,GBP |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CTNT |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA |
| ORF Protein Sequence | MACGLVASNLNLKPGECLRVRGEVAPDAKSFVLNLGKDSNNLCLHFNPRFNAHGDANTIVCNSKDGGAWGTEQREAVFPFQPGSVAEVCITFDQANLTVKLPDGYEFKFPNRLNLEAINYMAADGDFKIKCVAFD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T09544-Ab | Anti-LEG1/ LGALS1/ GAL1 functional antibody |
| Target Antigen | GM-Tg-g-T09544-Ag | LGALS1 protein |
| ORF Viral Vector | pGMLP001964 | Human LGALS1 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000545 | Human LGALS1 Adenovirus plasmid |
| ORF Viral Vector | pGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAP000003 | Human LGALS1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP001964 | Human LGALS1 Lentivirus particle |
| ORF Viral Vector | vGMAD000545 | Human LGALS1 Adenovirus particle |
| ORF Viral Vector | vGMAAV000234 | Human LGALS1 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAP000003 | Human LGALS1 Adenovirus particle |
Target information
| Target ID | GM-T09544 |
| Target Name | Galectin-1/LGALS1 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3956 |
| Gene ID |
100069841 (Equus caballus), 101098151 (Felis catus), 16852 (Mus musculus), 326598 (Bos taurus) 3956 (Homo sapiens), 56646 (Rattus norvegicus), 610276 (Canis lupus familiaris) |
| Gene Symbols & Synonyms | LGALS1,Lgals1,galectin-1,L14,Gal-1,Galbp,L-14.5,Lect14,GBP,GAL1 |
| Target Alternative Names | 14 kDa laminin-binding protein (HLBP14),14 kDa lectin,Beta-galactoside-binding lectin L-14-I,GAL1,GBP,Gal-1,Galaptin,Galbp,Galectin-1,HBL,HPL,L-14.5,L14,LGALS1,Lactose-binding lectin 1,Lect14,Lectin galactoside-binding soluble 1,Lgals1,Putative MAPK-activating protein PM12,S-Lac lectin 1,galectin-1 |
| Uniprot Accession |
P09382,P11116,P11762,P16045
Additional SwissProt Accessions: P16045,P11116,P09382,P11762 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target |
| Disease | cancer, Congenital occlusion of ureteropelvic junction |
| Disease from KEGG | |
| Gene Ensembl | ENSECAG00000006745, ENSMUSG00000068220, ENSBTAG00000015089, ENSG00000100097, ENSCAFG00845005881 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.