Human SHH/HHG1/HLP3 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_000193.3)
Cat. No.: vGMAAV000001
Pre-made Human SHH/HHG1/HLP3 Adeno-associated virus particle for SHH in-vivo study, mechanism of action (MOA) research and SHH-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go to
SHH/HHG1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
| vGMAAV000001 | Human SHH Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
| 5.0E+12VG/ml | ||||
| 1E+13VG/ml | ||||
| 5E+13VG/ml | ||||
| 1E+14VG/ml | ||||
| Research Grade | 1.0E+12VG/ml | |||
| 5.0E+12VG/ml | ||||
| 1E+13VG/ml | ||||
| 5E+13VG/ml | ||||
| 1E+14VG/ml | ||||
| GMP-like Grade | inquiry | |||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAAV000001 |
| Gene Name | SHH |
| Accession Number | NM_000193.3 |
| Gene ID | 6469 |
| Species | Human |
| Product Type | Adeno-associate virus(AAV) particle (overexpression) |
| Insert Length | 1389 bp |
| Gene Alias | HHG1,HLP3,HPE3,MCOPCB5,ShhNC,SMMCI,TPT,TPTPS |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | Null |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCTGGTATGCTCGGGACTGGCGTGCGGACCGGGCAGGGGGTTCGGGAAGAGGAGGCACCCCAAAAAGCTGACCCCTTTAGCCTACAAGCAGTTTATCCCCAATGTGGCCGAGAAGACCCTAGGCGCCAGCGGAAGGTATGAAGGGAAGATCTCCAGAAACTCCGAGCGATTTAAGGAACTCACCCCCAATTACAACCCCGACATCATATTTAAGGATGAAGAAAACACCGGAGCGGACAGGCTGATGACTCAGAGGTGTAAGGACAAGTTGAACGCTTTGGCCATCTCGGTGATGAACCAGTGGCCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGGACGAAGATGGCCACCACTCAGAGGAGTCTCTGCACTACGAGGGCCGCGCAGTGGACATCACCACGTCTGACCGCGACCGCAGCAAGTACGGCATGCTGGCCCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCCAAGGCACATATCCACTGCTCGGTGAAAGCAGAGAACTCGGTGGCGGCCAAATCGGGAGGCTGCTTCCCGGGCTCGGCCACGGTGCACCTGGAGCAGGGCGGCACCAAGCTGGTGAAGGACCTGAGCCCCGGGGACCGCGTGCTGGCGGCGGACGACCAGGGCCGGCTGCTCTACAGCGACTTCCTCACTTTCCTGGACCGCGACGACGGCGCCAAGAAGGTCTTCTACGTGATCGAGACGCGGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTCTTTGTGGCGCCGCACAACGACTCGGCCACCGGGGAGCCCGAGGCGTCCTCGGGCTCGGGGCCGCCTTCCGGGGGCGCACTGGGGCCTCGGGCGCTGTTCGCCAGCCGCGTGCGCCCGGGCCAGCGCGTGTACGTGGTGGCCGAGCGTGACGGGGACCGCCGGCTCCTGCCCGCCGCTGTGCACAGCGTGACCCTAAGCGAGGAGGCCGCGGGCGCCTACGCGCCGCTCACGGCCCAGGGCACCATTCTCATCAACCGGGTGCTGGCCTCGTGCTACGCGGTCATCGAGGAGCACAGCTGGGCGCACCGGGCCTTCGCGCCCTTCCGCCTGGCGCACGCGCTCCTGGCTGCACTGGCGCCCGCGCGCACGGACCGCGGCGGGGACAGCGGCGGCGGGGACCGCGGGGGCGGCGGCGGCAGAGTAGCCCTAACCGCTCCAGGTGCTGCCGACGCTCCGGGTGCGGGGGCCACCGCGGGCATCCACTGGTACTCGCAGCTGCTCTACCAAATAGGCACCTGGCTCCTGGACAGCGAGGCCCTGCACCCGCTGGGCATGGCGGTCAAGTCCAGCTGA |
| ORF Protein Sequence | MLLLARCLLLVLVSSLLVCSGLACGPGRGFGKRRHPKKLTPLAYKQFIPNVAEKTLGASGRYEGKISRNSERFKELTPNYNPDIIFKDEENTGADRLMTQRCKDKLNALAISVMNQWPGVKLRVTEGWDEDGHHSEESLHYEGRAVDITTSDRDRSKYGMLARLAVEAGFDWVYYESKAHIHCSVKAENSVAAKSGGCFPGSATVHLEQGGTKLVKDLSPGDRVLAADDQGRLLYSDFLTFLDRDDGAKKVFYVIETREPRERLLLTAAHLLFVAPHNDSATGEPEASSGSGPPSGGALGPRALFASRVRPGQRVYVVAERDGDRRLLPAAVHSVTLSEEAAGAYAPLTAQGTILINRVLASCYAVIEEHSWAHRAFAPFRLAHALLAALAPARTDRGGDSGGGDRGGGGGRVALTAPGAADAPGAGATAGIHWYSQLLYQIGTWLLDSEALHPLGMAVKSS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T12075-Ab | Anti-SHH/ HHG1/ HLP3 monoclonal antibody |
| Target Antigen | GM-Tg-g-T12075-Ag | SHH VLP (virus-like particle) |
| ORF Viral Vector | pGMAAV000001 | Human SHH Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMLP-SPh-072 | Human SHH Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-212 | Human SHH Adenovirus plasmid |
| ORF Viral Vector | vGMAAV000001 | Human SHH Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMLP-SPh-072 | Human SHH Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-212 | Human SHH Adenovirus particle |
Target information
| Target ID | GM-T12075 |
| Target Name | SHH |
|
Gene Group Identifier (Target Gene ID in Homo species) |
6469 |
| Gene ID |
100147450 (Equus caballus), 111557492 (Felis catus), 20423 (Mus musculus), 286821 (Bos taurus) 29499 (Rattus norvegicus), 608860 (Canis lupus familiaris), 6469 (Homo sapiens), 716553 (Macaca mulatta) |
| Gene Symbols & Synonyms | SHH,Shh,Hx,Dsh,Hhg1,Hxl3,HHG-1,ShhNC,M100081,9530036O11Rik,TPT,HHG1,HLP3,HPE3,SMMCI,TPTPS,MCOPCB5 |
| Target Alternative Names | 9530036O11Rik,Dsh,HHG-1,HHG1,HLP3,HPE3,Hhg1,Hx,Hxl3,M100081,MCOPCB5,SHH,SMMCI,Shh,Shh unprocessed N-terminal signaling and C-terminal autoprocessing domains (ShhNC),ShhNC,Sonic hedgehog protein,TPT,TPTPS |
| Uniprot Accession |
Q15465,Q62226,Q63673
Additional SwissProt Accessions: Q62226,Q63673,Q15465 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | |
| Disease from KEGG | Axon guidance, Pathways in cancer, Proteoglycans in cancer, Basal cell carcinoma, Gastric cancer |
| Gene Ensembl | ENSECAG00000023075, ENSMUSG00000002633, ENSBTAG00000024552, ENSCAFG00845013237, ENSG00000164690, ENSMMUG00000062128 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


