Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human PYCARD/ASC/CARD5 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_013258)
Cat. No.: pGMPC001854
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PYCARD/ASC/CARD5 Non-Viral expression plasmid (overexpression vector) for mouse PYCARD overexpression in unique cell transient transfection and stable cell line development.
Datasheet
Go to
ASC/TMS1/PYCARD/PYCARD/ASC products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMPC001854 |
| Gene Name | PYCARD |
| Accession Number | NM_013258 |
| Gene ID | 29108 |
| Species | Human |
| Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
| Insert Length | 588 bp |
| Gene Alias | ASC,CARD5,TMS,TMS-1,TMS1 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | Null |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGGCGCGCGCGCGACGCCATCCTGGATGCGCTGGAGAACCTGACCGCCGAGGAGCTCAAGAAGTTCAAGCTGAAGCTGCTGTCGGTGCCGCTGCGCGAGGGCTACGGGCGCATCCCGCGGGGCGCGCTGCTGTCCATGGACGCCTTGGACCTCACCGACAAGCTGGTCAGCTTCTACCTGGAGACCTACGGCGCCGAGCTCACCGCTAACGTGCTGCGCGACATGGGCCTGCAGGAGATGGCCGGGCAGCTGCAGGCGGCCACGCACCAGGGCTCTGGAGCCGCGCCAGCTGGGATCCAGGCCCCTCCTCAGTCGGCAGCCAAGCCAGGCCTGCACTTTATAGACCAGCACCGGGCTGCGCTTATCGCGAGGGTCACAAACGTTGAGTGGCTGCTGGATGCTCTGTACGGGAAGGTCCTGACGGATGAGCAGTACCAGGCAGTGCGGGCCGAGCCCACCAACCCAAGCAAGATGCGGAAGCTCTTCAGTTTCACACCAGCCTGGAACTGGACCTGCAAGGACTTGCTCCTCCAGGCCCTAAGGGAGTCCCAGTCCTACCTGGTGGAGGACCTGGAGCGGAGCTGA |
| ORF Protein Sequence | MGRARDAILDALENLTAEELKKFKLKLLSVPLREGYGRIPRGALLSMDALDLTDKLVSFYLETYGAELTANVLRDMGLQEMAGQLQAATHQGSGAAPAGIQAPPQSAAKPGLHFIDQHRAALIARVTNVEWLLDALYGKVLTDEQYQAVRAEPTNPSKMRKLFSFTPAWNWTCKDLLLQALRESQSYLVEDLERS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0440-Ab | Anti-ASC/ PYCARD/ CARD5 functional antibody |
| Target Antigen | GM-Tg-g-SE0440-Ag | PYCARD protein |
| ORF Viral Vector | pGMLP004754 | Human PYCARD Lentivirus plasmid |
| ORF Viral Vector | pGMPC001854 | Human PYCARD Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP004754 | Human PYCARD Lentivirus particle |
Target information
| Target ID | GM-SE0440 |
| Target Name | ASC/TMS1/PYCARD |
|
Gene Group Identifier （Target Gene ID in Homo species) |
29108 |
| Gene ID | 100856347 (Canis lupus familiaris), 282817 (Rattus norvegicus), 29108 (Homo sapiens), 713563 (Macaca mulatta) |
| Gene Symbols & Synonyms | PYCARD,Pycard,Asc,ASC,TMS,TMS1,CARD5,TMS-1 |
| Target Alternative Names | ASC,Apoptosis-associated speck-like protein containing a CARD,Asc,CARD5,Caspase recruitment domain-containing protein 5,PYCARD,PYD and CARD domain-containing protein,Pycard,TMS,TMS-1,TMS1,Target of methylation-induced silencing 1,hASC |
| Uniprot Accession |
Q9ULZ3
Additional SwissProt Accessions: Q9ULZ3 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | |
| Disease | cancer |
| Disease from KEGG | NOD-like receptor signaling pathway, C-type lectin receptor signaling pathway, Pathogenic Escherichia coli infection, Pertussis, Legionellosis, Yersinia infection, Influenza A, Lipid and atherosclerosis |
| Gene Ensembl | ENSCAFG00845011935, ENSG00000103490, ENSMMUG00000051859 |
| Target Classification | Tumor-associated antigen (TAA) |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.