Human PPIB/CYP-S1/CYPB ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_000942.5)

Cat. No.: pGMPC001690
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PPIB/CYP-S1/CYPB Non-Viral expression plasmid (overexpression vector) for mouse PPIB overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to Cyclophilin B/PPIB/PPIB/CYP-S1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001690
Gene Name PPIB
Accession Number NM_000942.5
Gene ID 5479
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 651 bp
Gene Alias CYP-S1,CYPB,HEL-S-39,OI9,SCYLP
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGGTCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAGCCCTTTGCCATCGCCAAGGAGTAG
ORF Protein Sequence MLRLSERNMKVLLAAALIAGSVFFLLLPGPSAADEKKKGPKVTVKVYFDLRIGDEDVGRVIFGLFGKTVPKTVDNFVALATGEKGFGYKNSKFHRVIKDFMIQGGDFTRGDGTGGKSIYGERFPDENFKLKHYGPGWVSMANAGKDTNGSQFFITTVKTAWLDGKHVVFGKVLEGMEVVRKVESTKTDSRDKPLKDVIIADCGKIEVEKPFAIAKE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T25847-Ab Anti-PPIB/ B/ CYP-S1 functional antibody
    Target Antigen GM-Tg-g-T25847-Ag PPIB protein
    ORF Viral Vector pGMLP002164 Human PPIB Lentivirus plasmid
    ORF Viral Vector pGMPC001690 Human PPIB Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002164 Human PPIB Lentivirus particle


    Target information

    Target ID GM-T25847
    Target Name Cyclophilin B/PPIB
    Gene Group Identifier
    (Target Gene ID in Homo species)
    5479
    Gene ID 100066834 (Equus caballus), 101087581 (Felis catus), 19035 (Mus musculus), 281419 (Bos taurus)
    478337 (Canis lupus familiaris), 5479 (Homo sapiens), 64367 (Rattus norvegicus), 706757 (Macaca mulatta)
    Gene Symbols & Synonyms PPIB,Ppib,Cphn2,Cphn-2,CyP-20b,OI9,CYPB,SCYLP,CYP-S1,HEL-S-39,CypB,Scylp
    Target Alternative Names CYP-S1,CYPB,Cphn-2,Cphn2,CyP-20b,Cyclophilin B,CypB,HEL-S-39,OI9,PPIB,PPIase B,Peptidyl-prolyl cis-trans isomerase B,Ppib,Rotamase B,S-cyclophilin (SCYLP),SCYLP,Scylp
    Uniprot Accession P23284,P24368,P24369,P80311
    Additional SwissProt Accessions: P24369,P80311,P23284,P24368
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSMUSG00000032383, ENSBTAG00000016822, ENSCAFG00845022646, ENSG00000166794, ENSMMUG00000045241
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.