Human MASP2/MAP-2/MAP19 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_139208.3)
Cat. No.: pGMPC001363
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human MASP2/MAP-2/MAP19 Non-Viral expression plasmid (overexpression vector) for mouse MASP2 overexpression in unique cell transient transfection and stable cell line development.
Go to
MASP2/MAP-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMPC001363 |
| Gene Name | MASP2 |
| Accession Number | NM_139208.3 |
| Gene ID | 10747 |
| Species | Human |
| Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
| Insert Length | 558 bp |
| Gene Alias | MAP-2,MAP19,MASP-2,MASP1P1,sMAP |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGGCTGCTGACCCTCCTGGGCCTTCTGTGTGGCTCGGTGGCCACCCCCTTGGGCCCGAAGTGGCCTGAACCTGTGTTCGGGCGCCTGGCATCCCCCGGCTTTCCAGGGGAGTATGCCAATGACCAGGAGCGGCGCTGGACCCTGACTGCACCCCCCGGCTACCGCCTGCGCCTCTACTTCACCCACTTCGACCTGGAGCTCTCCCACCTCTGCGAGTACGACTTCGTCAAGCTGAGCTCGGGGGCCAAGGTGCTGGCCACGCTGTGCGGGCAGGAGAGCACAGACACGGAGCGGGCCCCTGGCAAGGACACTTTCTACTCGCTGGGCTCCAGCCTGGACATTACCTTCCGCTCCGACTACTCCAACGAGAAGCCGTTCACGGGGTTCGAGGCCTTCTATGCAGCCGAGGACATTGACGAGTGCCAGGTGGCCCCGGGAGAGGCGCCCACCTGCGACCACCACTGCCACAACCACCTGGGCGGTTTCTACTGCTCCTGCCGCGCAGGCTACGTCCTGCACCGTAACAAGCGCACCTGCTCAGAGCAGAGCCTCTAG |
| ORF Protein Sequence | MRLLTLLGLLCGSVATPLGPKWPEPVFGRLASPGFPGEYANDQERRWTLTAPPGYRLRLYFTHFDLELSHLCEYDFVKLSSGAKVLATLCGQESTDTERAPGKDTFYSLGSSLDITFRSDYSNEKPFTGFEAFYAAEDIDECQVAPGEAPTCDHHCHNHLGGFYCSCRAGYVLHRNKRTCSEQSL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-366 | Pre-Made Narsoplimab biosimilar, Whole mAb, Anti-MASP2 Antibody: Anti-MAP-2/MAP19/MASP-2/MASP1P1/sMAP therapeutic antibody |
| Target Antibody | GM-Tg-g-T07448-Ab | Anti-MASP2/ MAP19/ MASP-2 functional antibody |
| Target Antigen | GM-Tg-g-T07448-Ag | MASP2 protein |
| ORF Viral Vector | pGMLP001815 | Human MASP2 Lentivirus plasmid |
| ORF Viral Vector | pGMPC000574 | Human MASP2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001363 | Human MASP2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001388 | Human MASP2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP001815 | Human MASP2 Lentivirus particle |
Target information
| Target ID | GM-T07448 |
| Target Name | MASP2 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
10747 |
| Gene ID |
100056770 (Equus caballus), 101099568 (Felis catus), 10747 (Homo sapiens), 17175 (Mus musculus) 487447 (Canis lupus familiaris), 505819 (Bos taurus), 64459 (Rattus norvegicus), 722714 (Macaca mulatta) |
| Gene Symbols & Synonyms | MASP2,Masp2,sMAP,MAP-2,MAP19,MASP-2,MASP1P1,MAp19 |
| Target Alternative Names | MAP-2,MAP19,MASP-2,MASP1P1,MASP2,MAp19,MBL-associated serine protease 2,Mannan-binding lectin serine protease 2,Mannose-binding protein-associated serine protease 2 (MASP-2),Masp2,sMAP |
| Uniprot Accession |
O00187,Q91WP0,Q9JJS8
Additional SwissProt Accessions: O00187,Q91WP0,Q9JJS8 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, INN Index |
| Disease | Acute appendicitis, Dent disease, Contrast - Induced Nephropathy, Congenital occlusion of ureteropelvic junction, Type 2 diabetes mellitus with diabetic nephropathy |
| Disease from KEGG | Complement and coagulation cascades, Staphylococcus aureus infection |
| Gene Ensembl | ENSECAG00000021756, ENSG00000009724, ENSMUSG00000028979, ENSCAFG00845003035, ENSBTAG00000012808, ENSMMUG00000007459 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


