Human FTH1/FHC/FTH ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002032.3)
Cat. No.: pGMPC001052
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human FTH1/FHC/FTH Non-Viral expression plasmid (overexpression vector) for mouse FTH1 overexpression in unique cell transient transfection and stable cell line development.
Go to
Ferritin heavy chain/FTH1/FTH1/FHC products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMPC001052 |
Gene Name | FTH1 |
Accession Number | NM_002032.3 |
Gene ID | 2495 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 552 bp |
Gene Alias | FHC,FTH,FTHL6,HFE5,PIG15,PLIF |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAA |
ORF Protein Sequence | MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T89873-Ab | Anti-FTH1 monoclonal antibody |
Target Antigen | GM-Tg-g-T89873-Ag | FTH1 protein |
ORF Viral Vector | pGMLV000307 | Human FTH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000308 | Human FTH1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000151 | Human FTH1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000822 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001052 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000307 | Human FTH1 Lentivirus particle |
ORF Viral Vector | vGMLV000308 | Human FTH1 Lentivirus particle |
ORF Viral Vector | vGMAP000151 | Human FTH1 Adenovirus particle |
Target information
Target ID | GM-T89873 |
Target Name | Ferritin heavy chain/FTH1 |
Gene Group Identifier (Target Gene ID in Homo species) |
2495 |
Gene ID |
100062811 (Equus caballus), 14319 (Mus musculus), 2495 (Homo sapiens), 25319 (Rattus norvegicus) 281173 (Bos taurus), 403631 (Canis lupus familiaris), 574118 (Macaca mulatta), 654516 (Felis catus) |
Gene Symbols & Synonyms | FTH1,Fth1,FHC,Fth,HFt,MFH,FTH,HFE5,PLIF,FTHL6,NBIA9,PIG15 |
Target Alternative Names | Cell proliferation-inducing gene 15 protein,FHC,FTH,FTH1,FTHL6,Ferritin H subunit,Ferritin heavy chain,Fth,Fth1,HFE5,HFt,MFH,NBIA9,PIG15,PLIF |
Uniprot Accession |
O46414,P02794,P09528,P19132,Q2MHN2,Q8MIP0,Q95MP7
Additional SwissProt Accessions: Q8MIP0,P09528,P02794,P19132,O46414,Q95MP7,Q2MHN2 |
Uniprot Entry Name | |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | |
Disease from KEGG | Ferroptosis, Mineral absorption |
Gene Ensembl | ENSECAG00000008683, ENSMUSG00000024661, ENSG00000167996, ENSBTAG00000011184, ENSCAFG00845010380, ENSMMUG00000015146 |
Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.