Human CLDN1/CLD1/ILVASC ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_021101.5)

Cat. No.: pGMPC000975
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CLDN1/CLD1/ILVASC Non-Viral expression plasmid (overexpression vector) for mouse CLDN1 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to Claudin 1/CLDN1/CLDN1/CLD1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000975
Gene Name CLDN1
Accession Number NM_021101.5
Gene ID 9076
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 636 bp
Gene Alias CLD1,ILVASC,SEMP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAACGCGGGGCTGCAGCTGTTGGGCTTCATTCTCGCCTTCCTGGGATGGATCGGCGCCATCGTCAGCACTGCCCTGCCCCAGTGGAGGATTTACTCCTATGCCGGCGACAACATCGTGACCGCCCAGGCCATGTACGAGGGGCTGTGGATGTCCTGCGTGTCGCAGAGCACCGGGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGAAGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAGGTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATGACCCTATGACCCCAGTCAATGCCAGGTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGGAGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCCCTATCCAAAACCTGCACCTTCCAGCGGGAAAGACTACGTGTGA
ORF Protein Sequence MANAGLQLLGFILAFLGWIGAIVSTALPQWRIYSYAGDNIVTAQAMYEGLWMSCVSQSTGQIQCKVFDSLLNLSSTLQATRALMVVGILLGVIAIFVATVGMKCMKCLEDDEVQKMRMAVIGGAIFLLAGLAILVATAWYGNRIVQEFYDPMTPVNARYEFGQALFTGWAAASLCLLGGALLCCSCPRKTTSYPTPRPYPKPAPSSGKDYV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0271-Ab Anti-CLD1/ CLDN1/ ILVASC monoclonal antibody
    Target Antigen GM-Tg-g-MP0271-Ag CLDN1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000077 Human CLDN1 Lentivirus plasmid
    ORF Viral Vector pGMLV001928 Human CLDN1 Lentivirus plasmid
    ORF Viral Vector pGMPC000975 Human CLDN1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000077 Human CLDN1 Lentivirus particle
    ORF Viral Vector vGMLV001928 Human CLDN1 Lentivirus particle


    Target information

    Target ID GM-MP0271
    Target Name Claudin 1/CLDN1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    9076
    Gene ID 100059811 (Equus caballus), 101094619 (Felis catus), 12737 (Mus musculus), 414922 (Bos taurus)
    608207 (Canis lupus familiaris), 65129 (Rattus norvegicus), 704330 (Macaca mulatta), 9076 (Homo sapiens)
    Gene Symbols & Synonyms CLDN1,Cldn1,claudin-1,CLD1,SEMP1,ILVASC
    Target Alternative Names CLD1,CLDN1,Claudin 1,Claudin-1,Cldn1,ILVASC,SEMP1,Senescence-associated epithelial membrane protein,claudin-1
    Uniprot Accession O88551,O95832,P56745,Q6L708
    Additional SwissProt Accessions: O88551,Q6L708,P56745,O95832
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease cancer
    Disease from KEGG Cell adhesion molecules, Tight junction, Leukocyte transendothelial migration, Pathogenic Escherichia coli infection, Hepatitis C
    Gene Ensembl ENSECAG00000021074, ENSMUSG00000022512, ENSBTAG00000013148, ENSCAFG00845024289, ENSMMUG00000001915, ENSG00000163347
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.