Human CCND1/BCL1/D11S287E ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_053056)

Cat. No.: pGMPC000351
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCND1/BCL1/D11S287E Non-Viral expression plasmid (overexpression vector) for mouse CCND1 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to Cyclin D1/CCND1/CCND1/BCL1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000351
Gene Name CCND1
Accession Number NM_053056
Gene ID 595
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 888 bp
Gene Alias BCL1,D11S287E,PRAD1,U21B31
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCCAACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCCTCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTCGCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGACCCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGCCAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAGGTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGA
ORF Protein Sequence MEHQLLCCEVETIRRAYPDANLLNDRVLRAMLKAEETCAPSVSYFKCVQKEVLPSMRKIVATWMLEVCEEQKCEEEVFPLAMNYLDRFLSLEPVKKSRLQLLGATCMFVASKMKETIPLTAEKLCIYTDNSIRPEELLQMELLLVNKLKWNLAAMTPHDFIEHFLSKMPEAEENKQIIRKHAQTFVALCATDVKFISNPPSMVAAGSVVAAVQGLNLRSPNNFLSYYRLTRFLSRVIKCDPDCLRACQEQIEALLESSLRQAQQNMDPKAAEEEEEEEEEVDLACTPTDVRDVDI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T12355-Ab Anti-CCND1 monoclonal antibody
    Target Antigen GM-Tg-g-T12355-Ag CCND1 protein
    ORF Viral Vector pGMLP005612 Human CCND1 Lentivirus plasmid
    ORF Viral Vector pGMLV000042 Human CCND1 Lentivirus plasmid
    ORF Viral Vector pGMLV000670 Human CCND1 Lentivirus plasmid
    ORF Viral Vector pGMLV002266 Human CCND1 Lentivirus plasmid
    ORF Viral Vector pGMAP000562 Human CCND1 Adenovirus plasmid
    ORF Viral Vector pGMPC000006 Human CCND1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000351 Human CCND1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005612 Human CCND1 Lentivirus particle
    ORF Viral Vector vGMLV000042 Human CCND1 Lentivirus particle
    ORF Viral Vector vGMLV000670 Human CCND1 Lentivirus particle
    ORF Viral Vector vGMLV002266 Human CCND1 Lentivirus particle
    ORF Viral Vector vGMAP000562 Human CCND1 Adenovirus particle


    Target information

    Target ID GM-T12355
    Target Name Cyclin D1/CCND1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    595
    Gene ID 100037407 (Felis catus), 102149114 (Equus caballus), 12443 (Mus musculus), 449028 (Canis lupus familiaris)
    524530 (Bos taurus), 574320 (Macaca mulatta), 58919 (Rattus norvegicus), 595 (Homo sapiens)
    Gene Symbols & Synonyms CCND1,Ccnd1,cD1,CycD1,Cyl-1,PRAD1,bcl-1,BCL1,U21B31,D11S287E
    Target Alternative Names B-cell lymphoma 1 protein (BCL-1),BCL-1 oncogene,BCL1,CCND1,Ccnd1,CycD1,Cyclin D1,Cyl-1,D11S287E,G1/S-specific cyclin-D1,PRAD1,PRAD1 oncogene,U21B31,bcl-1,cD1
    Uniprot Accession P24385,P25322,P39948,Q2KI22,Q64HP0
    Additional SwissProt Accessions: P25322,Q64HP0,Q2KI22,P39948,P24385
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer, Breast Cancer, Head and neck squamous cell carcinoma (HNSCC), tumor, Cancer, Breast cancer
    Disease from KEGG Endocrine resistance, FoxO signaling pathway, p53 signaling pathway, PI3K-Akt signaling pathway, Cellular senescence, Wnt signaling pathway, Hippo signaling pathway, Focal adhesion, Tight junction, JAK-STAT signaling pathway, Prolactin signaling pathway, Thyroid hormone signaling pathway, Oxytocin signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Cushing syndrome, Alcoholic liver disease, Hepatitis C, Measles, Human cytomegalovirus infection, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Proteoglycans in cancer, Chemical carcinogenesis - receptor activation, Colorectal cancer, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Thyroid cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer, Viral myocarditis
    Gene Ensembl ENSMUSG00000070348, ENSMMUG00000002368, ENSG00000110092
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.