Human PTPN2/PTN2/PTPT ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002828.4)

Cat. No.: pGMPC000312
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PTPN2/PTN2/PTPT Non-Viral expression plasmid (overexpression vector) for mouse PTPN2 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PTPN2/PTN2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000312
Gene Name PTPN2
Accession Number NM_002828.4
Gene ID 5771
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1248 bp
Gene Alias PTN2,PTPT,TC-PTP,TCELLPTP,TCPTP
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCACCACCATCGAGCGGGAGTTCGAAGAGTTGGATACTCAGCGTCGCTGGCAGCCGCTGTACTTGGAAATTCGAAATGAGTCCCATGACTATCCTCATAGAGTGGCCAAGTTTCCAGAAAACAGAAATCGAAACAGATACAGAGATGTAAGCCCATATGATCACAGTCGTGTTAAACTGCAAAATGCTGAGAATGATTATATTAATGCCAGTTTAGTTGACATAGAAGAGGCACAAAGGAGTTACATCTTAACACAGGGTCCACTTCCTAACACATGCTGCCATTTCTGGCTTATGGTTTGGCAGCAGAAGACCAAAGCAGTTGTCATGCTGAACCGCATTGTGGAGAAAGAATCGGTTAAATGTGCACAGTACTGGCCAACAGATGACCAAGAGATGCTGTTTAAAGAAACAGGATTCAGTGTGAAGCTCTTGTCAGAAGATGTGAAGTCGTATTATACAGTACATCTACTACAATTAGAAAATATCAATAGTGGTGAAACCAGAACAATATCTCACTTTCATTATACTACCTGGCCAGATTTTGGAGTCCCTGAATCACCAGCTTCATTTCTCAATTTCTTGTTTAAAGTGAGAGAATCTGGCTCCTTGAACCCTGACCATGGGCCTGCGGTGATCCACTGTAGTGCAGGCATTGGGCGCTCTGGCACCTTCTCTCTGGTAGACACTTGTCTTGTTTTGATGGAAAAAGGAGATGATATTAACATAAAACAAGTGTTACTGAACATGAGAAAATACCGAATGGGTCTTATTCAGACCCCAGATCAACTGAGATTCTCATACATGGCTATAATAGAAGGAGCAAAATGTATAAAGGGAGATTCTAGTATACAGAAACGATGGAAAGAACTTTCTAAGGAAGACTTATCTCCTGCCTTTGATCATTCACCAAACAAAATAATGACTGAAAAATACAATGGGAACAGAATAGGTCTAGAAGAAGAAAAACTGACAGGTGACCGATGTACAGGACTTTCCTCTAAAATGCAAGATACAATGGAGGAGAACAGTGAGAGTGCTCTACGGAAACGTATTCGAGAGGACAGAAAGGCCACCACAGCTCAGAAGGTGCAGCAGATGAAACAGAGGCTAAATGAGAATGAACGAAAAAGAAAAAGGTGGTTATATTGGCAACCTATTCTCACTAAGATGGGGTTTATGTCAGTCATTTTGGTTGGCGCTTTTGTTGGCTGGACACTGTTTTTTCAGCAAAATGCCCTATAA
ORF Protein Sequence MPTTIEREFEELDTQRRWQPLYLEIRNESHDYPHRVAKFPENRNRNRYRDVSPYDHSRVKLQNAENDYINASLVDIEEAQRSYILTQGPLPNTCCHFWLMVWQQKTKAVVMLNRIVEKESVKCAQYWPTDDQEMLFKETGFSVKLLSEDVKSYYTVHLLQLENINSGETRTISHFHYTTWPDFGVPESPASFLNFLFKVRESGSLNPDHGPAVIHCSAGIGRSGTFSLVDTCLVLMEKGDDINIKQVLLNMRKYRMGLIQTPDQLRFSYMAIIEGAKCIKGDSSIQKRWKELSKEDLSPAFDHSPNKIMTEKYNGNRIGLEEEKLTGDRCTGLSSKMQDTMEENSESALRKRIREDRKATTAQKVQQMKQRLNENERKRKRWLYWQPILTKMGFMSVILVGAFVGWTLFFQQNAL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T49156-Ab Anti-PTN2/ PTPN2/ PTPT monoclonal antibody
    Target Antigen GM-Tg-g-T49156-Ag PTPN2 VLP (virus-like particle)
    ORF Viral Vector pGMPC000312 Human PTPN2 Mammalian (Non-Viral Vector) plasmid


    Target information

    Target ID GM-T49156
    Target Name PTPN2
    Gene Group Identifier
    （Target Gene ID in Homo species)         		5771
    Gene ID 100057795 (Equus caballus), 101095923 (Felis catus), 114673846 (Macaca mulatta), 117063 (Rattus norvegicus)
    19255 (Mus musculus), 490563 (Canis lupus familiaris), 540888 (Bos taurus), 5771 (Homo sapiens)
    Gene Symbols & Synonyms PTPN2,Ptpn2,Ptpt,TC-PTP,PTN2,PTPT,TC45,TC48,TCPTP,TCELLPTP
    Target Alternative Names PTN2,PTPN2,PTPT,Ptpn2,Ptpt,T-cell protein-tyrosine phosphatase (TCPTP),TC-PTP,TC45,TC48,TCELLPTP,TCPTP,Tyrosine-protein phosphatase non-receptor type 2
    Uniprot Accession P17706,P35233,Q06180
    Additional SwissProt Accessions: P35233,Q06180,P17706
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG JAK-STAT signaling pathway
    Gene Ensembl ENSECAG00000000624, ENSMMUG00000055629, ENSMUSG00000024539, ENSCAFG00845005353, ENSBTAG00000010563, ENSG00000175354
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.