Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human CCL8/HC14/MCP-2 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_005623.3)
Cat. No.: pGMPC000252
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CCL8/HC14/MCP-2 Non-Viral expression plasmid (overexpression vector) for mouse CCL8 overexpression in unique cell transient transfection and stable cell line development.
Datasheet
Go to
CCL8/HC14 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMPC000252 |
| Gene Name | CCL8 |
| Accession Number | NM_005623.3 |
| Gene ID | 6355 |
| Species | Human |
| Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
| Insert Length | 300 bp |
| Gene Alias | HC14,MCP-2,MCP2,SCYA10,SCYA8 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGGTTTCTGCAGCGCTTCTGTGCCTGCTGCTCATGGCAGCCACTTTCAGCCCTCAGGGACTTGCTCAGCCAGATTCAGTTTCCATTCCAATCACCTGCTGCTTTAACGTGATCAATAGGAAAATTCCTATCCAGAGGCTGGAGAGCTACACAAGAATCACCAACATCCAATGTCCCAAGGAAGCTGTGATCTTCAAGACCAAACGGGGCAAGGAGGTCTGTGCTGACCCCAAGGAGAGATGGGTCAGGGATTCCATGAAGCATCTGGACCAAATATTTCAAAATCTGAAGCCATGA |
| ORF Protein Sequence | MKVSAALLCLLLMAATFSPQGLAQPDSVSIPITCCFNVINRKIPIQRLESYTRITNIQCPKEAVIFKTKRGKEVCADPKERWVRDSMKHLDQIFQNLKP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0751-Ab | Anti-CCL8/ HC14/ MCP-2 functional antibody |
| Target Antigen | GM-Tg-g-SE0751-Ag | CCL8 protein |
| Cytokine | cks-Tg-g-GM-SE0751 | chemokine (C-C motif) ligand 8 (CCL8) protein & antibody |
| ORF Viral Vector | pGMLP000800 | Human CCL8 Lentivirus plasmid |
| ORF Viral Vector | pGMPC000252 | Human CCL8 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP000800 | Human CCL8 Lentivirus particle |
Target information
| Target ID | GM-SE0751 |
| Target Name | CCL8 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
6355 |
| Gene ID | 100033927 (Equus caballus), 101097189 (Felis catus), 574179 (Macaca mulatta), 6355 (Homo sapiens) |
| Gene Symbols & Synonyms | CCL8,mcp-2,HC14,MCP2,MCP-2,SCYA8,SCYA10 |
| Target Alternative Names | CCL8,C-C motif chemokine 8,HC14, Monocyte chemoattractant protein 2, Monocyte chemotactic protein 2 (MCP-2), Small-inducible cytokine A8,HC14,MCP2,MCP-2,SCYA8,SCYA10 |
| Uniprot Accession |
P80075
Additional SwissProt Accessions: P80075 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Cytokine Target |
| Disease | |
| Disease from KEGG | Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, Chemokine signaling pathway |
| Gene Ensembl | ENSECAG00000034282, ENSMMUG00000009784, ENSG00000108700 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.