Human EFNB2/ephrin-B2/EPLG5 ORF/cDNA clone-Lentivirus plasmid (NM_004093.4)

Cat. No.: pGMLV002467
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human EFNB2/ephrin-B2/EPLG5 Lentiviral expression plasmid for EFNB2 lentivirus packaging, EFNB2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Ephrin B2/EFNB2/EFNB2/ephrin-B2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $580.56
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002467
Gene Name EFNB2
Accession Number NM_004093.4
Gene ID 1948
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1002 bp
Gene Alias ephrin-B2,EPLG5,Htk-L,HTKL,LERK5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Blasticidin (BSD)
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGTGAGAAGGGACTCCGTGTGGAAGTACTGCTGGGGTGTTTTGATGGTTTTATGCAGAACTGCGATTTCCAAATCGATAGTTTTAGAGCCTATCTATTGGAATTCCTCGAACTCCAAATTTCTACCTGGACAAGGACTGGTACTATACCCACAGATAGGAGACAAATTGGATATTATTTGCCCCAAAGTGGACTCTAAAACTGTTGGCCAGTATGAATATTATAAAGTTTATATGGTTGATAAAGACCAAGCAGACAGATGCACTATTAAGAAGGAAAATACCCCTCTCCTCAACTGTGCCAAACCAGACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTCAGCCCTAACCTCTGGGGTCTAGAATTTCAGAAGAACAAAGATTATTACATTATATCTACATCAAATGGGTCTTTGGAGGGCCTGGATAACCAGGAGGGAGGGGTGTGCCAGACAAGAGCCATGAAGATCCTCATGAAAGTTGGACAAGATGCAAGTTCTGCTGGATCAACCAGGAATAAAGATCCAACAAGACGTCCAGAACTAGAAGCTGGTACAAATGGAAGAAGTTCGACAACAAGTCCCTTTGTAAAACCAAATCCAGGTTCTAGCACAGACGGCAACAGCGCCGGACATTCGGGGAACAACATCCTCGGTTCCGAAGTGGCCTTATTTGCAGGGATTGCTTCAGGATGCATCATCTTCATCGTCATCATCATCACGCTGGTGGTCCTCTTGCTGAAGTACCGGAGGAGACACAGGAAGCACTCGCCGCAGCACACGACCACGCTGTCGCTCAGCACACTGGCCACACCCAAGCGCAGCGGCAACAACAACGGCTCAGAGCCCAGTGACATTATCATCCCGCTAAGGACTGCGGACAGCGTCTTCTGCCCTCACTACGAGAAGGTCAGCGGGGACTACGGGCACCCGGTGTACATCGTCCAGGAGATGCCCCCGCAGAGCCCGGCGAACATTTACTACAAGGTCTGA
ORF Protein Sequence MAVRRDSVWKYCWGVLMVLCRTAISKSIVLEPIYWNSSNSKFLPGQGLVLYPQIGDKLDIICPKVDSKTVGQYEYYKVYMVDKDQADRCTIKKENTPLLNCAKPDQDIKFTIKFQEFSPNLWGLEFQKNKDYYIISTSNGSLEGLDNQEGGVCQTRAMKILMKVGQDASSAGSTRNKDPTRRPELEAGTNGRSSTTSPFVKPNPGSSTDGNSAGHSGNNILGSEVALFAGIASGCIIFIVIIITLVVLLLKYRRRHRKHSPQHTTTLSLSTLATPKRSGNNNGSEPSDIIIPLRTADSVFCPHYEKVSGDYGHPVYIVQEMPPQSPANIYYKV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0398-Ab Anti-EFNB2/ EPLG5/ HTKL monoclonal antibody
    Target Antigen GM-Tg-g-MP0398-Ag EFNB2 VLP (virus-like particle)
    ORF Viral Vector pGMLV002467 Human EFNB2 Lentivirus plasmid
    ORF Viral Vector pGMPC000583 Human EFNB2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002467 Human EFNB2 Lentivirus particle


    Target information

    Target ID GM-MP0398
    Target Name Ephrin B2/EFNB2
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1948
    Gene ID 100064730 (Equus caballus), 100135769 (Felis catus), 100139818 (Bos taurus), 13642 (Mus musculus)
    1948 (Homo sapiens), 306636 (Rattus norvegicus), 611745 (Canis lupus familiaris), 711288 (Macaca mulatta)
    Gene Symbols & Synonyms EFNB2,Efnb2,Epl5,ELF-2,Eplg5,Htk-L,Lerk5,LERK-5,NLERK-1,HTKL,EPLG5,LERK5,ephrin-B2
    Target Alternative Names EFNB2,ELF-2,EPH-related receptor tyrosine kinase ligand 5 (LERK-5),EPLG5,Efnb2,Ephrin B2,Ephrin-B2,Epl5,Eplg5,HTK ligand (HTK-L),HTKL,Htk-L,LERK-5,LERK5,Lerk5,NLERK-1,ephrin-B2
    Uniprot Accession P52799,P52800
    Additional SwissProt Accessions: P52800,P52799
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease cancer
    Disease from KEGG Axon guidance
    Gene Ensembl ENSECAG00000012348, ENSBTAG00000016991, ENSMUSG00000001300, ENSG00000125266, ENSCAFG00845027992, ENSMMUG00000009892
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.