Human NTF3/HDNF/NGF-2 ORF/cDNA clone-Lentivirus plasmid (NM_001102654.2)

Cat. No.: pGMLV002188
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NTF3/HDNF/NGF-2 Lentiviral expression plasmid for NTF3 lentivirus packaging, NTF3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Neurotrophin 3/NTF3/NTF3/HDNF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $503.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002188
Gene Name NTF3
Accession Number NM_001102654.2
Gene ID 4908
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 813 bp
Gene Alias HDNF,NGF-2,NGF2,NT-3,NT3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTTACTTTTGCCACGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTATGTGATATTTCTCGCTTATCTCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTGCCAGAAGACTCGCTCAATTCCCTCATTATTAAGCTGATCCAGGCAGATATTTTGAAAAACAAGCTCTCCAAGCAGATGGTGGACGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCTGAGGCTCCCCGAGAGCCGGAGCGGGGAGGGCCCGCCAAGTCAGCATTCCAGCCGGTGATTGCAATGGACACCGAACTGCTGCGACAACAGAGACGCTACAACTCACCGCGGGTCCTGCTGAGCGACAGCACCCCCTTGGAGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGCCCCGTGGTGGCGAACAGAACATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCACCGAGGGGAGTACTCGGTATGTGACAGTGAGAGTCTGTGGGTGACCGACAAGTCATCGGCCATCGACATTCGGGGACACCAGGTCACGGTGCTGGGGGAGATCAAAACGGGCAACTCTCCCGTCAAACAATATTTTTATGAAACGCGATGTAAGGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGTATTGATGATAAACACTGGAACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCACTGACTTCAGAGAACAATAAACTCGTGGGCTGGCGGTGGATACGGATAGACACGTCCTGTGTGTGTGCCTTGTCGAGAAAAATCGGAAGAACATGA
ORF Protein Sequence MVTFATILQVNKVMSILFYVIFLAYLRGIQGNNMDQRSLPEDSLNSLIIKLIQADILKNKLSKQMVDVKENYQSTLPKAEAPREPERGGPAKSAFQPVIAMDTELLRQQRRYNSPRVLLSDSTPLEPPPLYLMEDYVGSPVVANRTSRRKRYAEHKSHRGEYSVCDSESLWVTDKSSAIDIRGHQVTVLGEIKTGNSPVKQYFYETRCKEARPVKNGCRGIDDKHWNSQCKTSQTYVRALTSENNKLVGWRWIRIDTSCVCALSRKIGRT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32855-Ab Anti-NTF3/ HDNF/ NGF-2 functional antibody
    Target Antigen GM-Tg-g-T32855-Ag NTF3 protein
    ORF Viral Vector pGMLV002188 Human NTF3 Lentivirus plasmid
    ORF Viral Vector pGMAD000046 Human NTF3 Adenovirus plasmid
    ORF Viral Vector pGMAP000383 Human NTF3 Adenovirus plasmid
    ORF Viral Vector vGMLV002188 Human NTF3 Lentivirus particle
    ORF Viral Vector vGMAD000046 Human NTF3 Adenovirus particle
    ORF Viral Vector vGMAP000383 Human NTF3 Adenovirus particle


    Target information

    Target ID GM-T32855
    Target Name Neurotrophin 3/NTF3
    Gene Group Identifier
    （Target Gene ID in Homo species)         		4908
    Gene ID 100051839 (Equus caballus), 18205 (Mus musculus), 486731 (Canis lupus familiaris), 4908 (Homo sapiens)
    493963 (Felis catus), 532393 (Bos taurus), 721988 (Macaca mulatta), 81737 (Rattus norvegicus)
    Gene Symbols & Synonyms NTF3,Ntf3,Nt3,HDNF,NGF-2,Ntf-3,NT3,NGF2,NT-3
    Target Alternative Names Neurotrophin 3, NTF3,Neurotrophin-3,NT-3,HDNF, Nerve growth factor 2 (NGF-2), Neurotrophic factor,NT3,HDNF,NGF2,NT-3,NGF-2
    Uniprot Accession P18280,P20181,P20783,Q08DT3,Q9TST2
    Additional SwissProt Accessions: P20181,P20783,Q9TST2,Q08DT3,P18280
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Schizophrenia
    Disease from KEGG MAPK signaling pathway, Ras signaling pathway, PI3K-Akt signaling pathway, Neurotrophin signaling pathway
    Gene Ensembl ENSECAG00000024611, ENSMUSG00000049107, ENSCAFG00845030324, ENSG00000185652, ENSBTAG00000010223, ENSMMUG00000014646
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.