Human PROZ/PZ ORF/cDNA clone-Lentivirus plasmid (NM_003891.3)

Cat. No.: pGMLV002109
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PROZ/PZ Lentiviral expression plasmid for PROZ lentivirus packaging, PROZ lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to Protein Z/PROZ/PROZ/PZ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $636.84
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002109
Gene Name PROZ
Accession Number NM_003891.3
Gene ID 8858
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1203 bp
Gene Alias PZ
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGGCTGCGTCCCACTGCTCCAGGGCCTGGTCCTGGTCCTCGCCCTCCATCGTGTGGAGCCCTCAGTATTTCTCCCGGCCTCCAAAGCAAACGACGTTCTGGTGAGGTGGAAGCGTGCGGGCTCCTATCTTCTGGAAGAACTCTTCGAGGGAAACTTGGAAAAAGAATGTTATGAAGAAATCTGTGTCTATGAAGAAGCAAGAGAAGTGTTTGAAAATGAAGTAGTCACTGATGAATTCTGGAGACGATATAAGGGCGGCTCCCCGTGCATCTCCCAGCCCTGCCTCCACAACGGCTCTTGCCAGGACAGCATCTGGGGCTACACCTGCACCTGCTCCCCCGGCTATGAGGGCAGCAACTGCGAGCTGGCTAAAAATGAATGTCACCCAGAGCGGACTGATGGGTGTCAACACTTCTGCCTCCCAGGACAGGAATCCTACACATGCAGCTGTGCTCAGGGCTACAGGCTTGGTGAGGACCACAAACAGTGTGTGCCCCACGACCAGTGTGCCTGCGGGGTGCTGACCTCTGAGAAGCGTGCACCGGATCTACAGGACCTCCCGTGGCAGGTAAAGTTAACAAATTCCGAAGGAAAAGACTTCTGTGGTGGTGTTATAATACGGGAAAATTTTGTACTGACAACAGCAAAATGTTCACTGTTACACAGGAATATTACTGTAAAAACATATTTTAACAGAACGAGCCAAGACCCGCTGATGATCAAGATAACGCACGTCCATGTGCACATGCGGTATGACGCGGACGCGGGGGAGAATGACCTGTCACTGCTGGAGCTGGAGTGGCCCATCCAGTGCCCAGGTGCGGGGCTCCCCGTGTGCACCCCTGAGAAAGACTTCGCTGAGCACCTCCTCATCCCACGCACCAGGGGCCTCCTCAGCGGCTGGGCACGCAATGGCACTGACCTGGGCAACTCGCTGACCACGCGGCCTGTCACACTTGTGGAGGGGGAGGAGTGCGGGCAGGTCCTGAATGTGACTGTCACCACCAGGACCTACTGTGAGAGAAGCAGCGTGGCGGCCATGCACTGGATGGATGGAAGTGTGGTCACCAGAGAACACAGAGGCTCCTGGTTTCTCACGGGGGTCCTGGGCTCGCAGCCAGTAGGAGGGCAGGCTCACATGGTCCTTGTCACCAAGGTCTCCAGGTACTCACTCTGGTTTAAACAGATCATGAACTAA
ORF Protein Sequence MAGCVPLLQGLVLVLALHRVEPSVFLPASKANDVLVRWKRAGSYLLEELFEGNLEKECYEEICVYEEAREVFENEVVTDEFWRRYKGGSPCISQPCLHNGSCQDSIWGYTCTCSPGYEGSNCELAKNECHPERTDGCQHFCLPGQESYTCSCAQGYRLGEDHKQCVPHDQCACGVLTSEKRAPDLQDLPWQVKLTNSEGKDFCGGVIIRENFVLTTAKCSLLHRNITVKTYFNRTSQDPLMIKITHVHVHMRYDADAGENDLSLLELEWPIQCPGAGLPVCTPEKDFAEHLLIPRTRGLLSGWARNGTDLGNSLTTRPVTLVEGEECGQVLNVTVTTRTYCERSSVAAMHWMDGSVVTREHRGSWFLTGVLGSQPVGGQAHMVLVTKVSRYSLWFKQIMN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1208-Ab Anti-PROZ/ PZ functional antibody
    Target Antigen GM-Tg-g-SE1208-Ag PROZ protein
    ORF Viral Vector pGMLV002109 Human PROZ Lentivirus plasmid
    ORF Viral Vector vGMLV002109 Human PROZ Lentivirus particle


    Target information

    Target ID GM-SE1208
    Target Name Protein Z/PROZ
    Gene Group Identifier
    (Target Gene ID in Homo species)
    8858
    Gene ID 100067119 (Equus caballus), 306608 (Rattus norvegicus), 617946 (Bos taurus), 66901 (Mus musculus)
    696982 (Macaca mulatta), 8858 (Homo sapiens)
    Gene Symbols & Synonyms PROZ,Proz,1300015B06Rik,PZ
    Target Alternative Names 1300015B06Rik,PROZ,PZ,Protein Z,Proz,Vitamin K-dependent protein Z
    Uniprot Accession P00744,P22891,Q9CQW3
    Additional SwissProt Accessions: P00744,Q9CQW3,P22891
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000024697, ENSBTAG00000019440, ENSMUSG00000031445, ENSMMUG00000001039, ENSG00000126231
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.