Human SLC25A5/2F1/AAC2 ORF/cDNA clone-Lentivirus plasmid (NM_001152.5)

Cat. No.: pGMLV001848
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SLC25A5/2F1/AAC2 Lentiviral expression plasmid for SLC25A5 lentivirus packaging, SLC25A5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SLC25A5/2F1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $524.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001848
Gene Name SLC25A5
Accession Number NM_001152.5
Gene ID 292
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 897 bp
Gene Alias 2F1,AAC2,ANT2,T2,T3
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACAGATGCCGCTGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTGGCCGCAGCCATCTCCAAGACGGCGGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAGATCACTGCAGATAAGCAATACAAAGGCATTATAGACTGCGTGGTCCGTATTCCCAAGGAGCAGGGAGTTCTGTCCTTCTGGCGCGGTAACCTGGCCAATGTCATCAGATACTTCCCCACCCAGGCTCTTAACTTCGCCTTCAAAGATAAATACAAGCAGATCTTCCTGGGTGGTGTGGACAAGAGAACCCAGTTTTGGCTCTACTTTGCAGGGAATCTGGCATCGGGTGGTGCCGCAGGGGCCACATCCCTGTGTTTTGTGTACCCTCTTGATTTTGCCCGTACCCGTCTAGCAGCTGATGTGGGTAAAGCTGGAGCTGAAAGGGAATTCCGAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAAGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTATTATCATCTACCGAGCCGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCGGATCCCAAGAACACTCACATCGTCATCAGCTGGATGATCGCACAGACTGTCACTGCTGTTGCCGGGTTGACTTCCTATCCATTTGACACTGTTCGCCGCCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGACATCATGTACACAGGCACGCTTGACTGCTGGCGGAAGATTGCTCGTGATGAAGGAGGCAAAGCTTTTTTCAAGGGTGCATGGTCCAATGTTCTCAGAGGCATGGGTGGTGCTTTTGTGCTTGTCTTGTATGATGAAATCAAGAAGTACACATAA
ORF Protein Sequence MTDAAVSFAKDFLAGGVAAAISKTAVAPIERVKLLLQVQHASKQITADKQYKGIIDCVVRIPKEQGVLSFWRGNLANVIRYFPTQALNFAFKDKYKQIFLGGVDKRTQFWLYFAGNLASGGAAGATSLCFVYPLDFARTRLAADVGKAGAEREFRGLGDCLVKIYKSDGIKGLYQGFNVSVQGIIIYRAAYFGIYDTAKGMLPDPKNTHIVISWMIAQTVTAVAGLTSYPFDTVRRRMMMQSGRKGTDIMYTGTLDCWRKIARDEGGKAFFKGAWSNVLRGMGGAFVLVLYDEIKKYT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1688-Ab Anti-SLC25A5 monoclonal antibody
    Target Antigen GM-Tg-g-IP1688-Ag SLC25A5 protein
    ORF Viral Vector pGMLV001848 Human SLC25A5 Lentivirus plasmid
    ORF Viral Vector vGMLV001848 Human SLC25A5 Lentivirus particle


    Target information

    Target ID GM-IP1688
    Target Name SLC25A5
    Gene Group Identifier
    (Target Gene ID in Homo species)
    292
    Gene ID 100059103 (Equus caballus), 101082635 (Felis catus), 11740 (Mus musculus), 25176 (Rattus norvegicus)
    282479 (Bos taurus), 292 (Homo sapiens), 492093 (Canis lupus familiaris), 693502 (Macaca mulatta)
    Gene Symbols & Synonyms SLC25A5,Slc25a5,Ant2,T2,T3,2F1,AAC2,ANT2
    Target Alternative Names 2F1,AAC2,ADP,ADP/ATP translocase 2,ANT2,ATP carrier protein,ATP carrier protein 2,Adenine nucleotide translocator 2 (ANT 2),Ant2,SLC25A5,Slc25a5,Solute carrier family 25 member 5,T2,T3,fibroblast isoform
    Uniprot Accession P05141,P51881,Q09073,Q8SQH5
    Additional SwissProt Accessions: P51881,Q09073,Q8SQH5,P05141
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG Calcium signaling pathway, cGMP-PKG signaling pathway, Cellular senescence, Alzheimer disease, Influenza A, Human T-cell leukemia virus 1 infection
    Gene Ensembl ENSMUSG00000016319, ENSG00000005022, ENSCAFG00845020441
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.