Human PIM1/PIM ORF/cDNA clone-Lentivirus plasmid (NM_002648.4)
Cat. No.: pGMLV001605
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PIM1/PIM Lentiviral expression plasmid for PIM1 lentivirus packaging, PIM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PIM1/PIM products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV001605 |
| Gene Name | PIM1 |
| Accession Number | NM_002648.4 |
| Gene ID | 5292 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 942 bp |
| Gene Alias | PIM |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCTCTTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCCACCAAGCTGGCGCCCGGCAAGGAGAAGGAGCCCCTGGAGTCGCAGTACCAGGTGGGCCCGCTACTGGGCAGCGGCGGCTTCGGCTCGGTCTACTCAGGCATCCGCGTCTCCGACAACTTGCCGGTGGCCATCAAACACGTGGAGAAGGACCGGATTTCCGACTGGGGAGAGCTGCCTAATGGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGTGAGCTCGGGTTTCTCCGGCGTCATTAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGTTTCGTCCTGATCCTGGAGAGGCCCGAGCCGGTGCAAGATCTCTTCGACTTCATCACGGAAAGGGGAGCCCTGCAAGAGGAGCTGGCCCGCAGCTTCTTCTGGCAGGTGCTGGAGGCCGTGCGGCACTGCCACAACTGCGGGGTGCTCCACCGCGACATCAAGGACGAAAACATCCTTATCGACCTCAATCGCGGCGAGCTCAAGCTCATCGACTTCGGGTCGGGGGCGCTGCTCAAGGACACCGTCTACACGGACTTCGATGGGACCCGAGTGTATAGCCCTCCAGAGTGGATCCGCTACCATCGCTACCATGGCAGGTCGGCGGCAGTCTGGTCCCTGGGGATCCTGCTGTATGATATGGTGTGTGGAGATATTCCTTTCGAGCATGACGAAGAGATCATCAGGGGCCAGGTTTTCTTCAGGCAGAGGGTCTCTTCAGAATGTCAGCATCTCATTAGATGGTGCTTGGCCCTGAGACCATCAGATAGGCCAACCTTCGAAGAAATCCAGAACCATCCATGGATGCAAGATGTTCTCCTGCCCCAGGAAACTGCTGAGATCCACCTCCACAGCCTGTCGCCGGGGCCCAGCAAATAG |
| ORF Protein Sequence | MLLSKINSLAHLRAAPCNDLHATKLAPGKEKEPLESQYQVGPLLGSGGFGSVYSGIRVSDNLPVAIKHVEKDRISDWGELPNGTRVPMEVVLLKKVSSGFSGVIRLLDWFERPDSFVLILERPEPVQDLFDFITERGALQEELARSFFWQVLEAVRHCHNCGVLHRDIKDENILIDLNRGELKLIDFGSGALLKDTVYTDFDGTRVYSPPEWIRYHRYHGRSAAVWSLGILLYDMVCGDIPFEHDEEIIRGQVFFRQRVSSECQHLIRWCLALRPSDRPTFEEIQNHPWMQDVLLPQETAEIHLHSLSPGPSK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T50594-Ab | Anti-PIM1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T50594-Ag | PIM1 protein |
| ORF Viral Vector | pGMLP005380 | Human PIM1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001605 | Human PIM1 Lentivirus plasmid |
| ORF Viral Vector | pGMAD001584 | Human PIM1 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000309 | Human PIM1 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000811 | Human PIM1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP005380 | Human PIM1 Lentivirus particle |
| ORF Viral Vector | vGMLV001605 | Human PIM1 Lentivirus particle |
| ORF Viral Vector | vGMAD001584 | Human PIM1 Adenovirus particle |
| ORF Viral Vector | vGMAP000309 | Human PIM1 Adenovirus particle |
Target information
| Target ID | GM-T50594 |
| Target Name | PIM1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
5292 |
| Gene ID |
100053898 (Equus caballus), 114677751 (Macaca mulatta), 18712 (Mus musculus), 24649 (Rattus norvegicus) 281402 (Bos taurus), 493888 (Felis catus), 5292 (Homo sapiens) |
| Gene Symbols & Synonyms | PIM1,Pim1,Pim-1,pim-1,PIM |
| Target Alternative Names | PIM,PIM1,Pim-1,Pim1,Serine/threonine-protein kinase pim-1,pim-1 |
| Uniprot Accession |
P06803,P11309,P26794,Q95LJ0,Q9N0P9
Additional SwissProt Accessions: P06803,P26794,Q9N0P9,Q95LJ0,P11309 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | cancer |
| Disease from KEGG | JAK-STAT signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Pathways in cancer, Acute myeloid leukemia |
| Gene Ensembl | ENSECAG00000020563, ENSMUSG00000024014, ENSBTAG00000000396, ENSG00000137193 |
| Target Classification | Kinase, Tumor-associated antigen (TAA) |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


