Human CCL2/GDCF-2/HC11 ORF/cDNA clone-Lentivirus plasmid (NM_002982.4)
Cat. No.: pGMLV001561
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CCL2/GDCF-2/HC11 Lentiviral expression plasmid for CCL2 lentivirus packaging, CCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
MCP-1/CCL2/CCL2/GDCF-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV001561 |
| Gene Name | CCL2 |
| Accession Number | NM_002982.4 |
| Gene ID | 6347 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 300 bp |
| Gene Alias | GDCF-2,HC11,HSMCR30,MCAF,MCP-1,MCP1,SCYA2,SMC-CF |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAAGTCTCTGCCGCCCTTCTGTGCCTGCTGCTCATAGCAGCCACCTTCATTCCCCAAGGGCTCGCTCAGCCAGATGCAATCAATGCCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAATCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATCTTCAAGACCATTGTGGCCAAGGAGATCTGTGCTGACCCCAAGCAGAAGTGGGTTCAGGATTCCATGGACCACCTGGACAAGCAAACCCAAACTCCGAAGACTTGA |
| ORF Protein Sequence | MKVSAALLCLLLIAATFIPQGLAQPDAINAPVTCCYNFTNRKISVQRLASYRRITSSKCPKEAVIFKTIVAKEICADPKQKWVQDSMDHLDKQTQTPKT |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-094 | Pre-Made Carlumab biosimilar, Whole mAb, Anti-CCL2 Antibody: Anti-HC11/MCAF/MCP1/MCP-1/SCYA2/GDCF-2/SMC-CF/HSMCR30 therapeutic antibody |
| Target Antibody | GM-Tg-g-T11309-Ab | Anti-CCL2/ GDCF-2/ HC11 functional antibody |
| Target Antigen | GM-Tg-g-T11309-Ag | CCL2 protein |
| Cytokine | cks-Tg-g-GM-T11309 | chemokine (C-C motif) ligand 2 (CCL2) protein & antibody |
| ORF Viral Vector | pGMLP000392 | Human CCL2 Lentivirus plasmid |
| ORF Viral Vector | pGMLP005505 | Human CCL2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001561 | Human CCL2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001954 | Human CCL2 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000030 | Human CCL2 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000392 | Human CCL2 Lentivirus particle |
| ORF Viral Vector | vGMLP005505 | Human CCL2 Lentivirus particle |
| ORF Viral Vector | vGMLV001561 | Human CCL2 Lentivirus particle |
| ORF Viral Vector | vGMLV001954 | Human CCL2 Lentivirus particle |
| ORF Viral Vector | vGMAP000030 | Human CCL2 Adenovirus particle |
Target information
| Target ID | GM-T11309 |
| Target Name | MCP-1/CCL2 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
6347 |
| Gene ID | 20296 (Mus musculus), 574138 (Macaca mulatta), 6347 (Homo sapiens) |
| Gene Symbols & Synonyms | Ccl2,CCL2,JE,HC11,MCAF,MCP1,MCP-1,Scya2,Sigje,SMC-CF,SCYA2,GDCF-2,HSMCR30 |
| Target Alternative Names | C-C motif chemokine 2,CCL2,Ccl2,GDCF-2,HC11,HSMCR30,JE,MCAF,MCP-1,MCP1,Monocyte chemoattractant protein 1,Monocyte chemotactic and activating factor (MCAF),Monocyte chemotactic protein 1 (MCP-1),Monocyte secretory protein JE,SCYA2,SMC-CF,Scya2,Sigje,Small-inducible cytokine A2 |
| Uniprot Accession |
P10148,P13500,P61275
Additional SwissProt Accessions: P10148,P61275,P13500 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
| Disease | cancer, Breast Cancer, Systemic lupus erythematosus (SLE), Idiopathic hypoparathyroidism, IgA glomerulonephritis, Lupus Glomerulonephritis, Nephrotic syndrome, Nephrotic syndrome with focal and segmental glomerular lesions, Overactive bladder, Proteinuria, Renal fibrosis, Schistosomiasis, Tubulo-interstitial nephropathy in systemic lupus erythematosus, Urolithiasis, Vasculitis, Autosomal Dominant Polycystic Kidney Disease, Bacterial sepsis of newborn, Chronic Kidney Disease, Congenital hydronephrosis, Congenital occlusion of ureteropelvic junction, Diabetic Nephropathy, Glomerulonephritis, Hepatic fibrosis, Hydronephrosis with renal and ureteral calculous obstruction, Hypertension, Type 2 diabetes mellitus with diabetic nephropathy, breast cancer |
| Disease from KEGG | Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, Chemokine signaling pathway, NOD-like receptor signaling pathway, IL-17 signaling pathway, TNF signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Yersinia infection, Chagas disease, Malaria, Human cytomegalovirus infection, Influenza A, Rheumatoid arthritis, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis |
| Gene Ensembl | ENSMUSG00000035385, ENSG00000108691 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


