Human IGFBP3/BP-53/IBP3 ORF/cDNA clone-Lentivirus plasmid (NM_000598.5)

Cat. No.: pGMLV001497
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IGFBP3/BP-53/IBP3 Lentiviral expression plasmid for IGFBP3 lentivirus packaging, IGFBP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IGFBP3/BP-53 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $519
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001497
Gene Name IGFBP3
Accession Number NM_000598.5
Gene ID 3486
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 876 bp
Gene Alias BP-53,IBP3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGCGGGCGCGACCCACGCTCTGGGCCGCTGCGCTGACTCTGCTGGTGCTGCTCCGCGGGCCGCCGGTGGCGCGGGCTGGCGCGAGCTCGGCGGGCTTGGGTCCCGTGGTGCGCTGCGAGCCGTGCGACGCGCGTGCACTGGCCCAGTGCGCGCCTCCGCCCGCCGTGTGCGCGGAGCTGGTGCGCGAGCCGGGCTGCGGCTGCTGCCTGACGTGCGCACTGAGCGAGGGCCAGCCGTGCGGCATCTACACCGAGCGCTGTGGCTCCGGCCTTCGCTGCCAGCCGTCGCCCGACGAGGCGCGACCGCTGCAGGCGCTGCTGGACGGCCGCGGGCTCTGCGTCAACGCTAGTGCCGTCAGCCGCCTGCGCGCCTACCTGCTGCCAGCGCCGCCAGCTCCAGGAAATGCTAGTGAGTCGGAGGAAGACCGCAGCGCCGGCAGTGTGGAGAGCCCGTCCGTCTCCAGCACGCACCGGGTGTCTGATCCCAAGTTCCACCCCCTCCATTCAAAGATAATCATCATCAAGAAAGGGCATGCTAAAGACAGCCAGCGCTACAAAGTTGACTACGAGTCTCAGAGCACAGATACCCAGAACTTCTCCTCCGAGTCCAAGCGGGAGACAGAATATGGTCCCTGCCGTAGAGAAATGGAAGACACACTGAATCACCTGAAGTTCCTCAATGTGCTGAGTCCCAGGGGTGTACACATTCCCAACTGTGACAAGAAGGGATTTTATAAGAAAAAGCAGTGTCGCCCTTCCAAAGGCAGGAAGCGGGGCTTCTGCTGGTGTGTGGATAAGTATGGGCAGCCTCTCCCAGGCTACACCACCAAGGGGAAGGAGGACGTGCACTGCTACAGCATGCAGAGCAAGTAG
ORF Protein Sequence MQRARPTLWAAALTLLVLLRGPPVARAGASSAGLGPVVRCEPCDARALAQCAPPPAVCAELVREPGCGCCLTCALSEGQPCGIYTERCGSGLRCQPSPDEARPLQALLDGRGLCVNASAVSRLRAYLLPAPPAPGNASESEEDRSAGSVESPSVSSTHRVSDPKFHPLHSKIIIIKKGHAKDSQRYKVDYESQSTDTQNFSSESKRETEYGPCRREMEDTLNHLKFLNVLSPRGVHIPNCDKKGFYKKKQCRPSKGRKRGFCWCVDKYGQPLPGYTTKGKEDVHCYSMQSK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T33455-Ab Anti-IBP3/ IGFBP3/ BP-53 functional antibody
    Target Antigen GM-Tg-g-T33455-Ag IGFBP3 protein
    Cytokine cks-Tg-g-GM-T33455 insulin-like growth factor binding protein 3 (IGFBP3) protein & antibody
    ORF Viral Vector pGMLP004768 Human IGFBP3 Lentivirus plasmid
    ORF Viral Vector pGMLV001162 Human IGFBP3 Lentivirus plasmid
    ORF Viral Vector pGMLV001497 Human IGFBP3 Lentivirus plasmid
    ORF Viral Vector vGMLP004768 Human IGFBP3 Lentivirus particle
    ORF Viral Vector vGMLV001162 Human IGFBP3 Lentivirus particle
    ORF Viral Vector vGMLV001497 Human IGFBP3 Lentivirus particle


    Target information

    Target ID GM-T33455
    Target Name IGFBP3
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3486
    Gene ID 100034155 (Equus caballus), 100855619 (Canis lupus familiaris), 101080442 (Felis catus), 16009 (Mus musculus)
    24484 (Rattus norvegicus), 282261 (Bos taurus), 3486 (Homo sapiens), 696868 (Macaca mulatta)
    Gene Symbols & Synonyms IGFBP3,Igfbp3,IGFBP-3,IGgfbp3,IGF-BP3,IBP3,BP-53,IBP-3
    Target Alternative Names BP-53,IBP-3,IBP3,IGF-BP3,IGF-binding protein 3,IGFBP-3,IGFBP3,IGgfbp3,Igfbp3,Insulin-like growth factor-binding protein 3
    Uniprot Accession P15473,P17936,P20959,P47878
    Additional SwissProt Accessions: P47878,P15473,P20959,P17936
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease cancer, Ovary Cancer
    Disease from KEGG p53 signaling pathway, Cellular senescence, Growth hormone synthesis, secretion and action
    Gene Ensembl ENSECAG00000018104, ENSCAFG00845011212, ENSMUSG00000020427, ENSBTAG00000003994, ENSG00000146674, ENSMMUG00000013764
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.