Human CXCL8/GCP-1/GCP1 ORF/cDNA clone-Lentivirus plasmid (NM_000584.4)

Cat. No.: pGMLV001490
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CXCL8/GCP-1/GCP1 Lentiviral expression plasmid for CXCL8 lentivirus packaging, CXCL8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CXCL8/IL-8/IL8/CXCL8/GCP-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001490
Gene Name CXCL8
Accession Number NM_000584.4
Gene ID 3576
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 300 bp
Gene Alias GCP-1,GCP1,IL8,LECT,LUCT,LYNAP,MDNCF,MONAP,NAF,NAP-1,NAP1,SCYB8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGTGAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATACTCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACACTGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA
ORF Protein Sequence MTSKLAVALLAAFLISAALCEGAVLPRSAKELRCQCIKTYSKPFHPKFIKELRVIESGPHCANTEIIVKLSDGRELCLDPKENWVQRVVEKFLKRAENS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T22658-Ab Anti-IL8/ CXCL8/ GCP-1 functional antibody
    Target Antigen GM-Tg-g-T22658-Ag IL8/CXCL8 protein
    Cytokine cks-Tg-g-GM-T22658 interleukin 8 (IL8) protein & antibody
    ORF Viral Vector pGMLV000447 Human CXCL8 Lentivirus plasmid
    ORF Viral Vector pGMLV000943 Human CXCL8 Lentivirus plasmid
    ORF Viral Vector pGMLV001490 Human CXCL8 Lentivirus plasmid
    ORF Viral Vector pGMAD000710 Human CXCL8 Adenovirus plasmid
    ORF Viral Vector pGMAP000556 Human IL8 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-011 Human CXCL8 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-094 Human CXCL8 Adenovirus plasmid
    ORF Viral Vector vGMLV000447 Human CXCL8 Lentivirus particle
    ORF Viral Vector vGMLV000943 Human CXCL8 Lentivirus particle
    ORF Viral Vector vGMLV001490 Human CXCL8 Lentivirus particle
    ORF Viral Vector vGMAD000710 Human CXCL8 Adenovirus particle
    ORF Viral Vector vGMAP000556 Human IL8 Adenovirus particle
    ORF Viral Vector vGMLP-IL-011 Human CXCL8 Lentivirus particle
    ORF Viral Vector vGMAP-IL-094 Human CXCL8 Adenovirus particle


    Target information

    Target ID GM-T22658
    Target Name CXCL8/IL-8/IL8
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3576
    Gene ID 100037400 (Equus caballus), 280828 (Bos taurus), 3576 (Homo sapiens), 403850 (Canis lupus familiaris)
    613028 (Macaca mulatta)
    Gene Symbols & Synonyms CXCL8,IL8,IL-8,NAF,GCP1,LECT,LUCT,NAP1,GCP-1,LYNAP,MDNCF,MONAP,NAP-1,SCYB8
    Target Alternative Names C-X-C motif chemokine 8,CXCL8,Chemokine (C-X-C motif) ligand 8,Emoctakin,GCP-1,GCP1,Granulocyte chemotactic protein 1 (GCP-1),IL-8,IL8,Interleukin-8,LECT,LUCT,LYNAP,MDNCF,MONAP,Monocyte-derived neutrophil chemotactic factor (MDNCF),Monocyte-derived neutrophil-activating peptide (MONAP),NAF,NAP-1,NAP1,Neutrophil-activating protein 1 (NAP-1),Protein 3-10C,SCYB8,T-cell chemotactic factor
    Uniprot Accession O62812,P10145,P41324,P67813,P79255
    Additional SwissProt Accessions: O62812,P79255,P10145,P41324,P67813
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease
    Disease from KEGG Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, Chemokine signaling pathway, NF-kappa B signaling pathway, Phospholipase D signaling pathway, Cellular senescence, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, IL-17 signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Alcoholic liver disease, Epithelial cell signaling in Helicobacter pylori infection, Pathogenic Escherichia coli infection, Pertussis, Legionellosis, Yersinia infection, Chagas disease, Malaria, Amoebiasis, Hepatitis B, Human cytomegalovirus infection, Influenza A, Kaposi sarcoma-associated herpesvirus infection, Pathways in cancer, Bladder cancer, Rheumatoid arthritis, Lipid and atherosclerosis
    Gene Ensembl ENSECAG00000015342, ENSBTAG00000019716, ENSG00000169429, ENSMMUG00000060156
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.