Human SIRT3/SIR2L3 ORF/cDNA clone-Lentivirus plasmid (NM_012239.6)

Cat. No.: pGMLV001438
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SIRT3/SIR2L3 Lentiviral expression plasmid for SIRT3 lentivirus packaging, SIRT3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SIRT3/SIR2L3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $636
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001438
Gene Name SIRT3
Accession Number NM_012239.6
Gene ID 23410
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1200 bp
Gene Alias SIR2L3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGTTCTGGGGTTGGCGCGCCGCGGCAGCCCTCCGGCTGTGGGGCCGGGTAGTTGAACGGGTCGAGGCCGGGGGAGGCGTGGGGCCGTTTCAGGCCTGCGGCTGTCGGCTGGTGCTTGGCGGCAGGGACGATGTGAGTGCGGGGCTGAGAGGCAGCCATGGGGCCCGCGGTGAGCCCTTGGACCCGGCGCGCCCCTTGCAGAGGCCTCCCAGACCCGAGGTGCCCAGGGCATTCCGGAGGCAGCCGAGGGCAGCAGCTCCCAGTTTCTTCTTTTCGAGTATTAAAGGTGGAAGAAGGTCCATATCTTTTTCTGTGGGTGCTTCAAGTGTTGTTGGAAGTGGAGGCAGCAGTGACAAGGGGAAGCTTTCCCTGCAGGATGTAGCTGAGCTGATTCGGGCCAGAGCCTGCCAGAGGGTGGTGGTCATGGTGGGGGCCGGCATCAGCACACCCAGTGGCATTCCAGACTTCAGATCGCCGGGGAGTGGCCTGTACAGCAACCTCCAGCAGTACGATCTCCCGTACCCCGAGGCCATTTTTGAACTCCCATTCTTCTTTCACAACCCCAAGCCCTTTTTCACTTTGGCCAAGGAGCTGTACCCTGGAAACTACAAGCCCAACGTCACTCACTACTTTCTCCGGCTGCTTCATGACAAGGGGCTGCTTCTGCGGCTCTACACGCAGAACATCGATGGGCTTGAGAGAGTGTCGGGCATCCCTGCCTCAAAGCTGGTTGAAGCTCATGGAACCTTTGCCTCTGCCACCTGCACAGTCTGCCAAAGACCCTTCCCAGGGGAGGACATTCGGGCTGACGTGATGGCAGACAGGGTTCCCCGCTGCCCGGTCTGCACCGGCGTTGTGAAGCCCGACATTGTGTTCTTTGGGGAGCCGCTGCCCCAGAGGTTCTTGCTGCATGTGGTTGATTTCCCCATGGCAGATCTGCTGCTCATCCTTGGGACCTCCCTGGAGGTGGAGCCTTTTGCCAGCTTGACCGAGGCCGTGCGGAGCTCAGTTCCCCGACTGCTCATCAACCGGGACTTGGTGGGGCCCTTGGCTTGGCATCCTCGCAGCAGGGACGTGGCCCAGCTGGGGGACGTGGTTCACGGCGTGGAAAGCCTAGTGGAGCTTCTGGGCTGGACAGAAGAGATGCGGGACCTTGTGCAGCGGGAAACTGGGAAGCTTGATGGACCAGACAAATAG
ORF Protein Sequence MAFWGWRAAAALRLWGRVVERVEAGGGVGPFQACGCRLVLGGRDDVSAGLRGSHGARGEPLDPARPLQRPPRPEVPRAFRRQPRAAAPSFFFSSIKGGRRSISFSVGASSVVGSGGSSDKGKLSLQDVAELIRARACQRVVVMVGAGISTPSGIPDFRSPGSGLYSNLQQYDLPYPEAIFELPFFFHNPKPFFTLAKELYPGNYKPNVTHYFLRLLHDKGLLLRLYTQNIDGLERVSGIPASKLVEAHGTFASATCTVCQRPFPGEDIRADVMADRVPRCPVCTGVVKPDIVFFGEPLPQRFLLHVVDFPMADLLLILGTSLEVEPFASLTEAVRSSVPRLLINRDLVGPLAWHPRSRDVAQLGDVVHGVESLVELLGWTEEMRDLVQRETGKLDGPDK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T91959-Ab Anti-SIRT3 monoclonal antibody
    Target Antigen GM-Tg-g-T91959-Ag SIRT3 protein
    ORF Viral Vector pGMLP002811 Human SIRT3 Lentivirus plasmid
    ORF Viral Vector pGMLV000991 Human SIRT3 Lentivirus plasmid
    ORF Viral Vector pGMLV001438 Human SIRT3 Lentivirus plasmid
    ORF Viral Vector pGMAD000249 Human SIRT3 Adenovirus plasmid
    ORF Viral Vector pGMAD000464 Human SIRT3 Adenovirus plasmid
    ORF Viral Vector pGMPC000237 Human SIRT3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000393 Human SIRT3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000866 Human SIRT3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002811 Human SIRT3 Lentivirus particle
    ORF Viral Vector vGMLV000991 Human SIRT3 Lentivirus particle
    ORF Viral Vector vGMLV001438 Human SIRT3 Lentivirus particle
    ORF Viral Vector vGMAD000249 Human SIRT3 Adenovirus particle
    ORF Viral Vector vGMAD000464 Human SIRT3 Adenovirus particle


    Target information

    Target ID GM-T91959
    Target Name SIRT3
    Gene Group Identifier
    (Target Gene ID in Homo species)
    23410
    Gene ID 100054908 (Equus caballus), 101087609 (Felis catus), 23410 (Homo sapiens), 293615 (Rattus norvegicus)
    475933 (Canis lupus familiaris), 614027 (Bos taurus), 64384 (Mus musculus), 720737 (Macaca mulatta)
    Gene Symbols & Synonyms SIRT3,Sirt3,SIR2L3,Sir2l3,2310003L23Rik
    Target Alternative Names 2310003L23Rik,NAD-dependent protein deacetylase sirtuin-3,NAD-dependent protein delactylase sirtuin-3,Regulatory protein SIR2 homolog 3,SIR2-like protein 3,SIR2L3,SIRT3,Sir2l3,Sirt3,hSIRT3,mitochondrial
    Uniprot Accession Q8R104,Q9NTG7
    Additional SwissProt Accessions: Q9NTG7,Q8R104
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Metabolic pathways, Central carbon metabolism in cancer
    Gene Ensembl ENSECAG00000003330, ENSG00000142082, ENSCAFG00845028357, ENSBTAG00000002044, ENSMUSG00000025486, ENSMMUG00000008490
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.